View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_94 (Length: 205)
Name: NF19782_low_94
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 9278533 - 9278345
Alignment:
| Q |
1 |
ctcaaaagttgaaacaatttgctttggtctatatgttcttgtaaacgtttacaagtgcatggaagatgttttgaaattggcaatgacccaacaagcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278533 |
ctcaaaagttgaaacaatttgctttggtctatatgttcttgtaaacgtttacaagtgcatggaagatgttttgaaattggcaatgacccaacaagcatta |
9278434 |
T |
 |
| Q |
101 |
ttctctcacaaaaatgagaaatgggttgatgagttagtagaatgcccggttagattcttagacatattaggagaaactagagatgttat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278433 |
ttctctcacaaaaatgagaaatgggttgatgagttagtagaatgcccggttagattcttagacatattaggagaaactagagatgttat |
9278345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 28536420 - 28536513
Alignment:
| Q |
13 |
aacaatttgctttggtctatatgttcttgtaaacgtttacaagtgcatggaagatgttttgaaattggcaatgacccaacaagcattattctctcac |
109 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||| ||||||||||| | ||||||||||||||||||||| | ||||| ||| ||||||| |
|
|
| T |
28536420 |
aacattttgctttagtctatatgtccttgtaaacgtttac--gtgcatggaag-ttttttgaaattggcaatgaccctagaagcactatactctcac |
28536513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University