View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19784_high_4 (Length: 251)
Name: NF19784_high_4
Description: NF19784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19784_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 103 - 235
Target Start/End: Complemental strand, 22443977 - 22443845
Alignment:
| Q |
103 |
tgaggacgttataactcattgtggaggttttcgttaataagttggaattagtgtgtcacaacaaaccgataagataaaaatacgtttaaaggactaaaga |
202 |
Q |
| |
|
||||||| |||||||| || |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22443977 |
tgaggacattataactggttatggaggttctcgttaataagttggaattagcgtgtcacaacaaaccgataagataaaaatacgtttaaaggaataaaga |
22443878 |
T |
 |
| Q |
203 |
aaataactcttaatttttactttataaaattct |
235 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
22443877 |
aaataactctcaatttttactttataaaattct |
22443845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 3 - 63
Target Start/End: Complemental strand, 22444143 - 22444083
Alignment:
| Q |
3 |
tggaggagcagagatggaggattcgttgaaagagatgtcacagttgggatgaatatttgat |
63 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
22444143 |
tggaggagtcgagatggaggatttgttgaaagagatgtcagagttggggtaaatatttgat |
22444083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University