View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19785_high_4 (Length: 225)
Name: NF19785_high_4
Description: NF19785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19785_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 71 - 182
Target Start/End: Complemental strand, 28626401 - 28626290
Alignment:
| Q |
71 |
ttgaatggagaaaaatgcatatctagctaaaaactgagagttacttttacaagttgagattctctcctttccttaggaaatggaagtgtctgttattatt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28626401 |
ttgaatggagaaaaatgcatatctagctaagaactgagagttacttttacaagttgagattctctcctttccttaggaaatggaagtgtctgttattatt |
28626302 |
T |
|
| Q |
171 |
ttttatgaggaa |
182 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28626301 |
ttttatgaggaa |
28626290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 28626495 - 28626450
Alignment:
| Q |
13 |
aatattcacaaaattgcagggtcgaattatggatattgcatgaaac |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28626495 |
aatattcacaaaattgcagggtcgaattatggatattgaatgaaac |
28626450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University