View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_high_105 (Length: 201)
Name: NF19786_high_105
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_high_105 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 41170610 - 41170793
Alignment:
| Q |
18 |
atttcaaggggggacttttaggtgagtttactactgaatgcatatattgccatgaatgtcgggaaattctctatttatcatttttgtttgccaaaaccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170610 |
atttcaaggggggacttttaggtgagtttactactgaatgcatatattgccatgaatgttgggaaattctctatttatcatttttgtttgccaaaaccaa |
41170709 |
T |
 |
| Q |
118 |
taactccgggctttgtacaaccccttgcagcatttcaaacttaggaatgtatcccgtggataaattctgtgctattataaatcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41170710 |
taactccgggctttgtacaaccccttgcagcatttcaaacttaggaatgtatcctgtggataaattctgtgctattataaatcc |
41170793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University