View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_high_80 (Length: 263)
Name: NF19786_high_80
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_high_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 36107556 - 36107316
Alignment:
| Q |
17 |
aaaataaagttcaaccttgcaaaaatcaatgaccaattccagggctagggacagatacaataagaactcgattcatgcttatgaggtggcgttctatgag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36107556 |
aaaataaagttcaaccttgcaaaaatcaatgaccaattccagggctagggacagatacaataagaactcgatccatgcttatgaggtggcgttctatgag |
36107457 |
T |
|
| Q |
117 |
cttctcatctacaacgtcagcatgcccnnnnnnngttggagaagaagatggcacggtacccttaggaagtgcacttcgaaacaaaccatcccttgaagat |
216 |
Q |
| |
|
||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36107456 |
cttctcatcaacaaccacagcatgccctttttttgttggagaagaagatggcacggtacccttaggaagtgcacttcgaaacaaaccatcccttgaagat |
36107357 |
T |
|
| Q |
217 |
tgcttcatcatgttcatctttttccactgcttctctgctcc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36107356 |
tgcttcatcatgttcatctttttccactgcttttctgctcc |
36107316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University