View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_high_97 (Length: 216)
Name: NF19786_high_97
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_high_97 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 196
Target Start/End: Complemental strand, 6734967 - 6734782
Alignment:
| Q |
11 |
gagcagcacagagacctacaaggtttgggagattgttgtttgtgacaatgccattgagtttagggttaactaatggaattcctccagtaatagggaagag |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6734967 |
gagcagcactgagacctacaaggtttgggagattgttgtttgtgacaatgccattgagtttagggttaactaatggaattcctccagtaatagggaagag |
6734868 |
T |
 |
| Q |
111 |
attgttgttgagcttggagaatggtaagccggttacatcactgtttgctacaattcctgctactactcttgctgatggatgtgatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6734867 |
attgttgttgagcttggagaatggtaagccggttacatcactgtttgctacaattcctgctaccactcttgctgatggatgtgatc |
6734782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 43 - 194
Target Start/End: Original strand, 52200110 - 52200261
Alignment:
| Q |
43 |
ttgttgtttgtgacaatgccattgagtttagggttaactaatggaattcctccagtaatagggaagagattgttgttgagcttggagaatggtaagccgg |
142 |
Q |
| |
|
||||||||||||| ||||||||||| || ||| | ||||| || |||||||| || || ||||||| ||||||||| |||||||| |||||||| | |
|
|
| T |
52200110 |
ttgttgtttgtgatgatgccattgagcttggggatgactaagggtattcctcctgtgattgggaagatgttgttgttgtttttggagaagggtaagcctg |
52200209 |
T |
 |
| Q |
143 |
ttacatcactgtttgctacaattcctgctactactcttgctgatggatgtga |
194 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||||||||||||||| ||||| |
|
|
| T |
52200210 |
ttacatcactgtttgctactattccggttactactcttgctgatgggtgtga |
52200261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University