View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_101 (Length: 237)
Name: NF19786_low_101
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 5107216 - 5107007
Alignment:
| Q |
11 |
aagcataggaagttaggtgatatgtcacatatgcaaaatggtggtgaggactgtgatgatcattttgaggttagctttgaattgggatctgagttggaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107216 |
aagcataggaagttaggtgatatgtcacatatgcaaaatggtggtgaggactgtgatgatcattttgaggttagctttgaattgggatctgagttggaaa |
5107117 |
T |
|
| Q |
111 |
ttgaagtgttgagaagaatttcaaacactcttgctgccaatgattgcttagatatatgcattgacatttatgttaaggtaacatccttttgattatctat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5107116 |
ttgaagtgttgagaagaatttcaaacactcttgctgccaatgattgcttagatatatgcattgacatctatgttaaggtaacatccttttgattatctat |
5107017 |
T |
|
| Q |
211 |
gatcatgttg |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
5107016 |
gatcatgttg |
5107007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University