View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_102 (Length: 220)
Name: NF19786_low_102
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 36627553 - 36627448
Alignment:
| Q |
1 |
tcaatcggggataaagctcctatggttctattcaactggctgcgacaatttaccaatgtaaaatcattgattgtttcttcaactactctgcaggtacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36627553 |
tcaatcggggataaagctcctatggttctatttaactggctgcgagaatttaccaatgtaaaatcattgattgtttcctcaactactctgcaggtacctt |
36627454 |
T |
 |
| Q |
101 |
gtcatg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
36627453 |
gtcatg |
36627448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 36627384 - 36627348
Alignment:
| Q |
170 |
aaccaaccaattgacttgtaatttatcctcattcccc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36627384 |
aaccaaccaattgacttgtaatttatcctcattcccc |
36627348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 35969074 - 35969156
Alignment:
| Q |
17 |
ctcctatggttctattcaactggctgcgacaatttaccaatgtaaaatcattgattgtttcttcaactactctgcaggtacct |
99 |
Q |
| |
|
|||||||||||||||| | |||||||| | | | ||||||||||||||||||| || ||||||| |||||| ||||||||| |
|
|
| T |
35969074 |
ctcctatggttctattgagctggctgctagacctcgccaatgtaaaatcattgatagtctcttcaattactcttcaggtacct |
35969156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 106
Target Start/End: Complemental strand, 36612656 - 36612606
Alignment:
| Q |
56 |
atgtaaaatcattgattgtttcttcaactactctgcaggtaccttgtcatg |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
36612656 |
atgtaaaatcattgacagtttcttcaactactcttcaggtactttgtcatg |
36612606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 89
Target Start/End: Complemental strand, 36636269 - 36636197
Alignment:
| Q |
17 |
ctcctatggttctattcaactggctgcgacaatttaccaatgtaaaatcattgattgtttcttcaactactct |
89 |
Q |
| |
|
||||| || |||||||| ||||||||| | | || ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
36636269 |
ctcctttgattctattcgactggctgctaaaccttgccaatgtaaaatcattgatggtctcttcaactactct |
36636197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University