View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_110 (Length: 201)
Name: NF19786_low_110
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 185
Target Start/End: Complemental strand, 42423543 - 42423371
Alignment:
| Q |
13 |
gcagagacatttgatatattgggtgccgtgttataacgtgcaatatccatcttttccatatatagtagctctattggggggtgtactagattataacaac |
112 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42423543 |
gcagagacatttgatatgttgggtgtcgtgttataacgtgcaatatccatcttttccatatatagtagctctattgggggatgtactagattataacaac |
42423444 |
T |
 |
| Q |
113 |
catcaaaaccttttcaactaactaatttgtacttaatatagtaagtactatcaacaaattatgggttaatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
42423443 |
catcaaaaccttttcaactaactaatttgtacttaatatagtaagtactatcaactaattatgggtcaatctt |
42423371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University