View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19786_low_111 (Length: 201)

Name: NF19786_low_111
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19786_low_111
NF19786_low_111
[»] chr1 (1 HSPs)
chr1 (18-201)||(41170610-41170793)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 41170610 - 41170793
Alignment:
18 atttcaaggggggacttttaggtgagtttactactgaatgcatatattgccatgaatgtcgggaaattctctatttatcatttttgtttgccaaaaccaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41170610 atttcaaggggggacttttaggtgagtttactactgaatgcatatattgccatgaatgttgggaaattctctatttatcatttttgtttgccaaaaccaa 41170709  T
118 taactccgggctttgtacaaccccttgcagcatttcaaacttaggaatgtatcccgtggataaattctgtgctattataaatcc 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
41170710 taactccgggctttgtacaaccccttgcagcatttcaaacttaggaatgtatcctgtggataaattctgtgctattataaatcc 41170793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University