View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19786_low_17 (Length: 599)

Name: NF19786_low_17
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19786_low_17
NF19786_low_17
[»] chr4 (3 HSPs)
chr4 (357-586)||(49484093-49484322)
chr4 (16-89)||(49496123-49496196)
chr4 (470-518)||(55072199-55072247)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 4e-55; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 357 - 586
Target Start/End: Original strand, 49484093 - 49484322
Alignment:
357 ttgatgttcaggtagtttgcagataaaacgagatcaaacaaatttatacggtcaacattgatgaattcaacatcctaatccttgagatcaacatctgaca 456  Q
    |||||||||| |||||||| ||||||||| || ||||||||| || ||  || |||||||| ||||||||||||| ||||| ||||||||||||||||||    
49484093 ttgatgttcatgtagtttgaagataaaacaaggtcaaacaaagttgtatagtgaacattgacgaattcaacatcccaatccatgagatcaacatctgaca 49484192  T
457 tttgtgtgttcttgtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcactaaagaaagagaaatgctattgatatcaccagcaggatt 556  Q
    |||||| ||||||||||||||||||||||||||||||| ||| ||| | || |||| ||||||||||||||||||| | ||| | |||||||| |||||     
49484193 tttgtgcgttcttgtgcttcttgcagtattcaatgaccatggccaatattttgctactcactaaagaaagagaaatacaattaacatcaccagtaggatc 49484292  T
557 gatctccatagcatcctggattgtttttga 586  Q
      |||| ||||||||||  |||||||||||    
49484293 tgtctcaatagcatcctcaattgtttttga 49484322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 49496123 - 49496196
Alignment:
16 atgaacaaattaaactgagacaaatctctattaatatgataattctactagaaccgttcattctaagaattaaa 89  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
49496123 atgaacaaattaaactgagacaaatctatattaatatgataattctactagaaccgttcattctaagaattaaa 49496196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 518
Target Start/End: Complemental strand, 55072247 - 55072199
Alignment:
470 gtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcact 518  Q
    |||||||||||||||||||| |||| || |||||| || ||||||||||    
55072247 gtgcttcttgcagtattcaacgaccatgctcaacattttgctattcact 55072199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University