View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_17 (Length: 599)
Name: NF19786_low_17
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 4e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 357 - 586
Target Start/End: Original strand, 49484093 - 49484322
Alignment:
| Q |
357 |
ttgatgttcaggtagtttgcagataaaacgagatcaaacaaatttatacggtcaacattgatgaattcaacatcctaatccttgagatcaacatctgaca |
456 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || ||||||||| || || || |||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
49484093 |
ttgatgttcatgtagtttgaagataaaacaaggtcaaacaaagttgtatagtgaacattgacgaattcaacatcccaatccatgagatcaacatctgaca |
49484192 |
T |
 |
| Q |
457 |
tttgtgtgttcttgtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcactaaagaaagagaaatgctattgatatcaccagcaggatt |
556 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||| ||| | || |||| ||||||||||||||||||| | ||| | |||||||| ||||| |
|
|
| T |
49484193 |
tttgtgcgttcttgtgcttcttgcagtattcaatgaccatggccaatattttgctactcactaaagaaagagaaatacaattaacatcaccagtaggatc |
49484292 |
T |
 |
| Q |
557 |
gatctccatagcatcctggattgtttttga |
586 |
Q |
| |
|
|||| |||||||||| ||||||||||| |
|
|
| T |
49484293 |
tgtctcaatagcatcctcaattgtttttga |
49484322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 49496123 - 49496196
Alignment:
| Q |
16 |
atgaacaaattaaactgagacaaatctctattaatatgataattctactagaaccgttcattctaagaattaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496123 |
atgaacaaattaaactgagacaaatctatattaatatgataattctactagaaccgttcattctaagaattaaa |
49496196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 518
Target Start/End: Complemental strand, 55072247 - 55072199
Alignment:
| Q |
470 |
gtgcttcttgcagtattcaatgaccttggtcaacaattcgctattcact |
518 |
Q |
| |
|
|||||||||||||||||||| |||| || |||||| || |||||||||| |
|
|
| T |
55072247 |
gtgcttcttgcagtattcaacgaccatgctcaacattttgctattcact |
55072199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University