View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_48 (Length: 395)
Name: NF19786_low_48
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 15 - 355
Target Start/End: Complemental strand, 40008996 - 40008656
Alignment:
| Q |
15 |
aaaagggttatcattatcttcattatttaacattttttcaagccaaaagatttaaaattttgcatcattaaacaacttggctataagaaaataaagacat |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40008996 |
aaaagggttatcattatcttcattagttaacattttttcaagccaaaagatttaaaattttgcatcattaaacaacttggctataagaaaataaagacat |
40008897 |
T |
|
| Q |
115 |
gaagaaaaataaagagggagtagaatggaacattgagagcttgttgaatagtggaatcaacggctgcgtagagacgagcgaatccatcatcaccataggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40008896 |
gaagaaaaataaagagggagtagaatggaacattgagagcttgttgaatagtggaatcaacggctgcgtagagacgagcgaatccatcatcaccataggc |
40008797 |
T |
|
| Q |
215 |
attgagttcacgttgtttatcaatgtcgtatttgtcatattttttgcatatgtcgtcgacacggaagagaatgtcgatgacagacattgttgttttggtt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40008796 |
gttgagttcacgttgtttatcaatgtcgtatttgtcatattttttgcatatgtcgtcgacacggaagagaatgtcgatgacagacattgttgttttggtt |
40008697 |
T |
|
| Q |
315 |
ttttcttgtcttgagaaaaacaagggggaggttaaggttgc |
355 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40008696 |
ttttcttgtcttgagaaaaacaaggggaaggttaaggttgc |
40008656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University