View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_59 (Length: 342)
Name: NF19786_low_59
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 38136735 - 38136426
Alignment:
| Q |
18 |
gtggtaagactacatcctaattttcacgctttgacatatatacatgcatacatacaaattaacaaatacatgaggtggcaaaaactgattcggttctaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
38136735 |
gtggtaagactacatcctaattttcacgctttgacatatatacatgcatacatacaaattaacaaatacatgaggtggcaaaa-ctgatttggttctaca |
38136637 |
T |
 |
| Q |
118 |
gaccaacctgtttaaacaggtagatcgtagggcaggccaaaacgaggcgggttgcccagttttgccacctttaaatacaaccattcattcctatttccaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38136636 |
gaccaacctgtttaaacaggtagatcgtagggcaggccaaaacgaggcgggttgcccagttttgccatctttaaatacaaccattcattcctatttccaa |
38136537 |
T |
 |
| Q |
218 |
aaaattcctatttctaaaaactttagctcatgtttagactagtttgttttgataatctgtatctttttgtagcttggagatatggtacaatcagggactt |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136536 |
aaacttcctatttctaaaaactttagctcatgtttagactagtttgttttgataatctgtatctttttgtagcttggagatatggtacaatcagggactt |
38136437 |
T |
 |
| Q |
318 |
gtgctcatatc |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
38136436 |
gtgctcatatc |
38136426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 254 - 328
Target Start/End: Original strand, 39316639 - 39316718
Alignment:
| Q |
254 |
gactagtttgttttgataatctg-----tatctttttgtagcttggagatatggtacaatcagggacttgtgctcatatc |
328 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
39316639 |
gactagtttgttttgataatatgaaatgtatctaattgtagcttggagatatggtacaatcaaggactagtactcatatc |
39316718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University