View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_60 (Length: 339)
Name: NF19786_low_60
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_60 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 6 - 339
Target Start/End: Original strand, 26612205 - 26612537
Alignment:
| Q |
6 |
atatatttctctctttatgctccatgattacaataatttggtgttataagaa-tgtcttgtaaatctcaattgatattgatcccttcttcaatataaaga |
104 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||||||||| ||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26612205 |
atatctttctctctttttcctccatgattacaataattttgtgctataagaaatgtcttgtaaatcttaattgatattgatcccttcttcaatataaaga |
26612304 |
T |
|
| Q |
105 |
tttcccatataaacaataaacattgtgttctaaaggttcgatttctcagcccaatttgccttcaatatatcttattgatcatatgaaacatttataagta |
204 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
26612305 |
tttcgcatataaacaataaacgttgtgttctaaaggttcgatttctcagcccaatttaccttcaattt--cttattgatcatatgaaaaatttataagta |
26612402 |
T |
|
| Q |
205 |
tcataatcattcacattacaatatccaccatattttttgcaagatcatatgtattcgagagaaaagattattggaggttagaattagaagatagttttta |
304 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26612403 |
tcatattcattcatattacaatatccaccatattttttgcaagatcatatgtattcgagagaagagattattggaggttagaattagaagatagttttta |
26612502 |
T |
|
| Q |
305 |
aatgctttctcttatcaaatatatatcaaactttc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26612503 |
aatgctttctcttatcaaatatatatcaaactttc |
26612537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University