View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_71 (Length: 289)
Name: NF19786_low_71
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 33203679 - 33203899
Alignment:
| Q |
5 |
actagttttcaaaataattttatggttttaataaaatcattttccaaacacagttacattgtggtatctaattcaacatagttttatttttattttcatn |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203679 |
actagttttcaaaataattttatggttttaataaaatcattttccaaacacagttacattctggtatctaattcaacatagttttatttttattttcata |
33203778 |
T |
 |
| Q |
105 |
nnnnnnctttatttgccccaaaatgtcattcattgaatacttgtatatgcttttgaaaataaaattaaaatgtatgaagagtacttttgtgattcactga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
33203779 |
aaaaaactttatttgccccaaaatgtcattcattgaatacttgtatatgcttttgataataaaattaaaatgta-gaagagta-ttttgtgattcactga |
33203876 |
T |
 |
| Q |
205 |
atatctgtatatccttacaaaaa |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33203877 |
atatctgtatatccttacaaaaa |
33203899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 33203535 - 33203591
Alignment:
| Q |
19 |
taattttatggttttaataaaatcattttccaaacacagttacattgtggtatctaa |
75 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33203535 |
taattttattgttttaataaaatcattttccaaacacaattacattctggtatctaa |
33203591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University