View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_77 (Length: 282)
Name: NF19786_low_77
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 39 - 237
Target Start/End: Complemental strand, 42466247 - 42466048
Alignment:
| Q |
39 |
ggcgatgcgggttgtgttctaagagtgattcttaaattctagtcaatactgtttacttgaatcgacaaggctcatatgagtt-agtacaattgttttcgg |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42466247 |
ggcgatgcgggttgtgttccaagagtgattcttaaattctagtcaatactgtttacttgaatcgacaaggctcatatgagtttagtacaattgttttcgg |
42466148 |
T |
|
| Q |
138 |
tattgtttcttttctcattatatttaaactttgaggtccagtttattaaaagacaaatgagtatggttgttgattctcttgtaagggaaaccactttctt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42466147 |
tattgtttcttttctcattatatttaaactttgaggtcaagtttattaaaagacaaatgagtatggttgttgattcccttgtaagggaaaccactttctt |
42466048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University