View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_87 (Length: 260)
Name: NF19786_low_87
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 51701652 - 51701897
Alignment:
| Q |
1 |
ccggtaaccaagaccatcagagccaccgcgttcgcgccacgcttccagtcttccccaaggcttccatgtaccatcaccaggacgaagaataagccatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51701652 |
ccggtaaccaagaccatcagagccaccgcgttcgcgccacgcttccagtcttccccaaggcttccatgtaccatcaccaggacgaagaataagccatgaa |
51701751 |
T |
|
| Q |
101 |
ccgggatttgagcagctaacccggtctgaaccgggagatgcaacgaaaggtgtgaccattgaagcagctgcaaccggtgaaccggaaaggtcgtgaaccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51701752 |
ccgggatttgagcagctaacccggtctgacccgggagatgcaacgaaaggtgtgaccattgaagcagctgcaaccggtgaaccggaaaggtcgtgaaccg |
51701851 |
T |
|
| Q |
201 |
taatggaccatcctttgcgttctttccctggacgttcacgttcact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51701852 |
taatggaccatcctttgcgttctttccctgtacgttcacgttcact |
51701897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 438349 - 438290
Alignment:
| Q |
127 |
tgaaccgggagatgcaacgaaaggtgtgaccattgaagcagctgcaaccggtgaaccgga |
186 |
Q |
| |
|
||||||||| || | |||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
438349 |
tgaaccgggtgaaggaacgaaaggtgtaaccattgaagcacacgcaaccggtgaaccgga |
438290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University