View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19786_low_91 (Length: 252)
Name: NF19786_low_91
Description: NF19786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19786_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 12406126 - 12406341
Alignment:
| Q |
16 |
aatatataagtgagatgacccatatagttaattaacactttaagattttgggtaaatatgtggtgttcaaactgacttgtgtaatagcccttagctcaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12406126 |
aatatataagtgagatgacccatatagttaa----cactttaagattttgggtaaatatgtggtgttcaaactgacttgtgtaatagcccttagctcaat |
12406221 |
T |
|
| Q |
116 |
gtgttgatccaccacagtgtagactcccttggaagtcccaacattgtcagaccctgacatgtgtcagacatgcctttaatatgaattgtcggtgttacat |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12406222 |
gtgttgatccaccacagtttagactcccctggaagtctcaacattgtcagaccctgacatgtgtcagacatgcctttaatatgaattgtcggtgttacat |
12406321 |
T |
|
| Q |
216 |
ttgattggtacctactattt |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12406322 |
ttgattggtacctactattt |
12406341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University