View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_high_34 (Length: 308)
Name: NF19787_high_34
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 298
Target Start/End: Original strand, 5564507 - 5564804
Alignment:
| Q |
1 |
aataatcatatagaactactgtattttggtatcgagttggagtttgaatatgatggtttcgtctgatccacatagtagcctaaataaacataatgggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5564507 |
aataatcatatagaactactgtattttggtatcgagttggagtttgaatatgatggtttcgtctgatccacatagtagcctaaataaacataatgggaaa |
5564606 |
T |
 |
| Q |
101 |
agattttgattgttgttgttgggtgtggtgcgttagggtgttattggctgtatattaggatgattagcaggtcagttatttagttggcattctagttgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5564607 |
agattttgattgttgttgttgggtgtggtgcgttagggtgttattggctgtatattaggatgattagcaggtcagttatttagtaggcattctagttgac |
5564706 |
T |
 |
| Q |
201 |
aaatacatggaataggattggtaaaatatctcatagtcataggattttagcatatctttttccctctggctattaaccttggcattctttctgttctt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5564707 |
aaatacatggaataggattggtaaaatatctcatagtcataggattttagcatatctttttccctctggctattaaccttggcattctttctattctt |
5564804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University