View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_high_68 (Length: 235)
Name: NF19787_high_68
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2389012 - 2388792
Alignment:
| Q |
1 |
tggtagccgttctagatcacgagaggaagcgaacatttgtgatacgaaaggaaggtcttccagatgttggtaagtgtctttcattctaaacaaatgacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389012 |
tggtagccgttctagatcacgagaggaagcgaacatttgtgatacgaaaggaaggtcttccagatgttggtaagtgtctttcattctaaacaaatgacat |
2388913 |
T |
 |
| Q |
101 |
ttcggacccaaaatctaagcactataattggaaaaacttctgtcattttgttacacaaacatgaaagataactaaaactaaccatccatgtcaactttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2388912 |
ttcggacccaaaatctaagcactataattggaaaaacttctgtcattttgttacacaaacatgaaagataattaaaactaaccatccatgtcaactttga |
2388813 |
T |
 |
| Q |
201 |
cattgaatagttgtttggaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2388812 |
cattgaatagttgtttggaat |
2388792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 74
Target Start/End: Original strand, 36809015 - 36809080
Alignment:
| Q |
9 |
gttctagatcacgagaggaagcgaacatttgtgatacgaaaggaaggtcttccagatgttggtaag |
74 |
Q |
| |
|
||||||||||| |||||||| ||||||| | | ||| ||||||||||||| || |||||||||||| |
|
|
| T |
36809015 |
gttctagatcatgagaggaaacgaacatatattataagaaaggaaggtctccctgatgttggtaag |
36809080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University