View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19787_high_70 (Length: 230)

Name: NF19787_high_70
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19787_high_70
NF19787_high_70
[»] chr5 (1 HSPs)
chr5 (31-230)||(2222847-2223046)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 2223046 - 2222847
Alignment:
31 gcccaatcaccgatataaacccaggtgacgtgggggcggtttctccggtggttgattccatcgtaggaaccaccgccactttgcatggacgctttctctt 130  Q
    ||||||||||||||||||| ||| |||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
2223046 gcccaatcaccgatataaaaccatgtgacgcggtggcggtttctccggtggttgattccatcgtaggaaccactgccactttgcatggacgctttctctt 2222947  T
131 ccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctc 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2222946 ccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctc 2222847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University