View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_high_70 (Length: 230)
Name: NF19787_high_70
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_high_70 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 2223046 - 2222847
Alignment:
| Q |
31 |
gcccaatcaccgatataaacccaggtgacgtgggggcggtttctccggtggttgattccatcgtaggaaccaccgccactttgcatggacgctttctctt |
130 |
Q |
| |
|
||||||||||||||||||| ||| |||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2223046 |
gcccaatcaccgatataaaaccatgtgacgcggtggcggtttctccggtggttgattccatcgtaggaaccactgccactttgcatggacgctttctctt |
2222947 |
T |
 |
| Q |
131 |
ccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222946 |
ccttctataatcatcgtaacgccgctcaatttctttagatttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctc |
2222847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University