View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_31 (Length: 324)
Name: NF19787_low_31
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 312
Target Start/End: Complemental strand, 374540 - 374222
Alignment:
| Q |
17 |
aaaacaagaaataattttttgttctcaaagtttatcaaaacttgggttttcagtcatttgttgagatttttgagccattcttttagacttaatt------ |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374540 |
aaaacaaaaaataattttttgttctcaaagtttatcaaaacttgggttttcagtcatttgttgagatttttgagccattcttttagacttaatttttgag |
374441 |
T |
|
| Q |
111 |
----------------gtgggggtggtgaggatgtttatgaatgtttttattctcaaagtttgatagnnnnnnnnnnnnnn-ctctattgggttttaatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
374440 |
tctgttagttcctattgtgggggtggtgaggatgtttatgaatgtttttattctcaaagtttgatagtttttatttttttttctctattgggttttaatt |
374341 |
T |
|
| Q |
194 |
ttccttgtgtatttgttccttttgtgaatggtggggtgtttgtgccaattgaggaccttggaagttattgaagttagtaaattattaattttaattattg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
374340 |
ttccttgtgtatttgttccttttgtgaatggtggggtgtttgtgccaattgaggaccttggaagttattgaagttagtaatttatgaattttaattattg |
374241 |
T |
|
| Q |
294 |
aattttgtttgttgatttt |
312 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
374240 |
aattttgtttgttgatttt |
374222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University