View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_37 (Length: 308)
Name: NF19787_low_37
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 174 - 300
Target Start/End: Complemental strand, 54717097 - 54716970
Alignment:
| Q |
174 |
atctcatacgaaggaattgaggttaaatatattttataaa-tattcaaatatcttgatctcgacttgtcctttttatttctatttttataaaggacaaaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54717097 |
atctcatacgaaggaattgaggttaaatatattttataaaatattcaaatatcttgatctcgacttgtcctttttatttctatttttataaaggacaaaa |
54716998 |
T |
 |
| Q |
273 |
cctaatatccctttctttgatgatgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54716997 |
cctaatatccctttctttgatgatgatg |
54716970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University