View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_42 (Length: 277)
Name: NF19787_low_42
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 268
Target Start/End: Complemental strand, 37745354 - 37745100
Alignment:
| Q |
14 |
caataccctcttttatactactctcacttgtcaaggtctttaatttcaatgtgccctttatgtaaatacaatacttttatatgacaaaatttgaaatttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745354 |
caataccctcttttatactactctcacttgtcaaggtctttaatttcaatgtgccctttatgtaaatacaatacttttatatgacaaaatttgaaatttc |
37745255 |
T |
|
| Q |
114 |
atcaaatttattttcttgctttaatgacaattgtactcacattcagagaaatatacaacaaccacnnnnnnnntcattttatgtttcctct-nnnnnnnc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| | |
|
|
| T |
37745254 |
atcaaatttattttcttgctttaatgacaattgtactcacattcagagaaatatacaacaaccac-aaaaaaatcatttaatgtttcctctaaaaaaaac |
37745156 |
T |
|
| Q |
213 |
acaaaatcatatgataacttttaataatttatgttttatatcatattatgcctatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37745155 |
acaaaatcatatgataacttttaataatttatgttttatatcatattatgtctatg |
37745100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University