View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_49 (Length: 264)
Name: NF19787_low_49
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 47126523 - 47126771
Alignment:
| Q |
1 |
tagtaatgtttgatccaaggtctttcgtttttatggagctatcattcttcagtaaattggtacacannnnnnn-atcctttgttagatacatatcttgaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47126523 |
tagtaatgtttgatccaaggtctttcgtttttatggagctatcattcttcagtaaattggtacacattttttttatcctttgttagatacatatcttgaa |
47126622 |
T |
 |
| Q |
100 |
gcgcgtcatgacatggttataaggatccagttaaactttaccttatattgtgttaaaacatatctctactataaagtaaaattcacgttactacaccaac |
199 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126623 |
gcgtgtcatgacatagttataaggatccagttaaactttaccttatattgtgttaaaacatatctctactataaagtaaaattcacgttactacaccaac |
47126722 |
T |
 |
| Q |
200 |
gacattgaatgatttgagctcaaattctactaatatggtcgtataactt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126723 |
gacattgaatgatttgagctcaaattctactaatatggtcgtataactt |
47126771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University