View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_50 (Length: 262)
Name: NF19787_low_50
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 47409433 - 47409231
Alignment:
| Q |
18 |
tatttcaattttaaaaacgtatatgtttacttccctnnnnnnnncgtatatacttactatactatacttagnnnnnnnactaagaccatgatttgttctt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
47409433 |
tatttcaattttaaaaacgtatgtgtttacttccctaaaaaaaacgtatatatttactatactatacttagtttttttactaagactatgatttgttctt |
47409334 |
T |
|
| Q |
118 |
aacaaacacttgaaatttaatttgttactttagatgttataaatctttaactacaacttattttatccattattcactactactactcatacttctgctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47409333 |
aacaaacacttgaaatttaatttgttactttagatgttataaatctttaactacaacttattttatccattatttactactactactcatacttctgctt |
47409234 |
T |
|
| Q |
218 |
ctt |
220 |
Q |
| |
|
||| |
|
|
| T |
47409233 |
ctt |
47409231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University