View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_52 (Length: 261)
Name: NF19787_low_52
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 44287173 - 44286909
Alignment:
| Q |
1 |
ttcaactattcatgctgcatgtggaggtgttggtgtggttttggaagtcttgcttttgtgtttattgctactgtctgtatgttttttcctgtggccttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44287173 |
ttcaactattcatgctgcatgtggaggtgttggtgtggttttggaagtcttgcttttgtgtttattgctactgtctgtatgttttttcctgtggccttgt |
44287074 |
T |
|
| Q |
101 |
tctttttaattactaaatgcttctaacattg------------tacgtgaatttggataactagacatacatttaaatccttctataactttcatcaatt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44287073 |
tctttttaattactaaatgcttctaacattgtaacagtatcattacgtgaatttggataactagacatacatttaaatccttctataactttcatcattt |
44286974 |
T |
|
| Q |
189 |
gattatcccttatttatatctgctcaaacaccaaaaatcaagtcttgccttcttcaatctgtgct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44286973 |
gattatcccttatttatatctgctcaaacaccaaaaatcaagtcttgccttcttcaatcggtgct |
44286909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University