View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_64 (Length: 245)
Name: NF19787_low_64
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 36947461 - 36947316
Alignment:
| Q |
18 |
aattttctcctcgcctctttctagttggagcctaatgaaagcaaatatgataaattatatgaatgtggtgggtttgtgggcgtgtgtgttatcatgtaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||| | | ||| |||| |
|
|
| T |
36947461 |
aattttctcctcgcctctttctagttggagcctaatgaaagcaaatttgatgaattatatgaatgtggtgggtttgtgggtgtgtgtataaacatctaag |
36947362 |
T |
|
| Q |
118 |
attgaaatatttacaataatcttcactggagtattattgcagtttg |
163 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||||||| |||||| |
|
|
| T |
36947361 |
attgaaatatttacaacaattttcattggagtattattgtagtttg |
36947316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University