View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_66 (Length: 244)
Name: NF19787_low_66
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_66 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 6 - 244
Target Start/End: Original strand, 40368433 - 40368671
Alignment:
| Q |
6 |
aatattggtgtggtacaaataagccacttggatctcttaagtttgtgaagcatcatgtgatcaggttttttatctgaattatgtatatcaaaattcaccg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368433 |
aatattggtgtggtacaaataagccacttggatctcttaagtttgtgaagcatcatgtgatcaggttttttatctgaattatgtatatcaaaattcaccg |
40368532 |
T |
 |
| Q |
106 |
gttttgaagagtcgatcatttaaaactttgaagaatttagtctcagcaattgtgcgcgaaaaatgagatacaatccaaaattttatggtctctttctaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368533 |
gttttgaagagtcgatcatttaaaactttgaagaatttagtctcagcaattgtgcacgaaaaatgagatacaatccaaaattttatggtctctttctaaa |
40368632 |
T |
 |
| Q |
206 |
aatatcttcatatgttgataaatcatgtaaaaaaggaca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368633 |
aatatcttcatatgttgataaatcatgtaaaaaaggaca |
40368671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University