View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_69 (Length: 240)
Name: NF19787_low_69
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 1176088 - 1176285
Alignment:
| Q |
22 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1176088 |
ttcttcgcgcctccaaccctctgtcatcttctcacctttctccgaccctaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcaccgcc |
1176187 |
T |
 |
| Q |
122 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
1176188 |
gcctcttcttcctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggtgatcttcttttctcccgcactgtatca |
1176285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 32 - 219
Target Start/End: Complemental strand, 55038962 - 55038775
Alignment:
| Q |
32 |
ctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgccacctcttttt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||| || |
|
|
| T |
55038962 |
ctccaaccctctgtcatcttctcacccttctccgaccctaacaccaccagaatcgccacctcttctcttcaaagttgcaaccacaccgccgcctcttctt |
55038863 |
T |
 |
| Q |
132 |
cctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55038862 |
cctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggcgatcttcttttctcccgcactgtatca |
55038775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 5197063 - 5197260
Alignment:
| Q |
22 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
5197063 |
ttcttcgcgcctccaaccctctgtcatcttctcacctttctccgaccctaacaccactagaatcgccacctcttctcttcaaagttgcaaccacaccgcc |
5197162 |
T |
 |
| Q |
122 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatca |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
5197163 |
gcctcttcttcctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggtgatcttcttttctcccgcactgtatca |
5197260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 8004264 - 8004448
Alignment:
| Q |
22 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
121 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||||| ||| ||| |
|
|
| T |
8004264 |
ttctccgcgcttccaaccctctgtcatcttctcacccttctccaaccctaacaccaccagaatcgccacctcttctcttcaa-gttgcaaccacaccgcc |
8004362 |
T |
 |
| Q |
122 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcc |
207 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8004363 |
gcctcttcttcctcataaccactgccgcctgttttcaagctgttcagatccggaaatgtcacatcgccggcgatcttcttttctcc |
8004448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University