View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_81 (Length: 212)
Name: NF19787_low_81
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_81 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 43102645 - 43102448
Alignment:
| Q |
1 |
acatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgcccagttacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102645 |
acatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgcccagttacat |
43102546 |
T |
|
| Q |
101 |
tagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagttccagctgcctctgcagcctcc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43102545 |
tagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagtcccagctgcctctgcagcctcc |
43102448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University