View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19787_low_84 (Length: 204)
Name: NF19787_low_84
Description: NF19787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19787_low_84 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 9478646 - 9478820
Alignment:
| Q |
13 |
caaaggtaaaatatttgtagaaaaattcaaatgcaaaaattatatgaaaaccnnnnnnnnnnnnnnnnnnn-ggcttaaaattaatgaatatgaaattag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
9478646 |
caaaggtaaaatatttgtagaaaaattcaaatgcaaaaattatatgaaaatctcttttttatttttatttttggcttaaaattaatgaatatgaaattag |
9478745 |
T |
 |
| Q |
112 |
tatttatgtttcaattgcgagaattgactctctactaaataaaaaatcatatttgtcgtcaatgaatgacacaag |
186 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9478746 |
tatttatgtttcaatttcgagaattgactctctactaaataaaaaatcatatttgtcgtgaatgaatgacacaag |
9478820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University