View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19788_low_5 (Length: 327)
Name: NF19788_low_5
Description: NF19788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19788_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 317
Target Start/End: Complemental strand, 4214 - 3916
Alignment:
| Q |
19 |
gttggatgttccagaccagggcctcctatgtgatctcctttggtccgatccagacacagaagttaaagggtggggagagaatgatcgtggcgtttcctac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4214 |
gttggatgttccagaccagggcctcctatgtgatctcctttggtccgatccagacacagaagttaaagggtggggagagaatgatcgtggcgtttcctac |
4115 |
T |
|
| Q |
119 |
acatttggaccagacacggtagatgagttcttgnnnnnnnncgatctcgatcttatatgtcgggctcatcaggttaattttgttattcactactacacta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4114 |
acatttggaccagacacggtagatgagttcttgaagaaaaacgatctcgatcttatatgtcgggctcatcaggttaattttgttattcaccactacacta |
4015 |
T |
|
| Q |
219 |
cacattgatcattcattcatttatccattattgaataaactaaacaaacttattgtaaatttactcatacaggttgttgaagacggctaccaattcttc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4014 |
cacattgatcattcattcatttatccattattgaataaactaaacaaacttattgtaaatttactcatacaggttgttgaagacggctaccaattcttc |
3916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University