View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19789_high_2 (Length: 387)
Name: NF19789_high_2
Description: NF19789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19789_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 13 - 358
Target Start/End: Original strand, 45546358 - 45546703
Alignment:
| Q |
13 |
catcatcatcaggaatatgctgagtttcagtgtcatgtccactaccatgatcaaatacattctgaccatgcttcttaatactgtccctaactttcctagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546358 |
catcatcatcaggaatatgctgagtttcagtgtcatgtccactaccatgatcaaatacattctgaccatgcttcttaatactgtccctaactttcctagc |
45546457 |
T |
|
| Q |
113 |
ctttgccttcaccctactcataacagacttcttctcaggctcaggctcaggctcagtgggctcttctggtccatgtgtcaatgtcactgcatccaaaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
45546458 |
ctttgccttcaccctactcataacagacttcttctcaggctcaggctcagaattagtgggctcttctggtccatgtgtcagtgtcacttcatccaaaata |
45546557 |
T |
|
| Q |
213 |
gattcaaataaagtagnnnnnnntgcttcaaacttaaaaactaccaagtattgtatatattaactcttgcttcaaacaaaatgatatgatacctggatat |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546558 |
gattcaaataaagtagaaaaaaatgcttcaaacttaaaaactaccaagtatagtatatattaactcttgcttcaaacaaaatgatatgatacctggatat |
45546657 |
T |
|
| Q |
313 |
ggttcgacgttaggtgagttttgttcatcgttctccccttccacat |
358 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546658 |
ggttcaacgttaggtgagttttgttcatcgttctccccttccacat |
45546703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 148
Target Start/End: Original strand, 45551601 - 45551732
Alignment:
| Q |
17 |
atcatcaggaatatgctgagtttcagtgtcatgtccactaccatgatcaaatacattctgaccatgcttcttaatactgtccctaactttcctagccttt |
116 |
Q |
| |
|
||||||| || |||||||| ||||| ||| ||||||| |||||||||||| ||| | ||||| || || ||||| ||||| ||| |||| |||||||| |
|
|
| T |
45551601 |
atcatcatgagtatgctgaatttcattgttatgtccattaccatgatcaagtacttgttgaccgtgttttttaattgtgtccttaattttcttagccttt |
45551700 |
T |
|
| Q |
117 |
gccttcaccctactcataacagacttcttctc |
148 |
Q |
| |
|
||||||||| || ||| |||||| |||||||| |
|
|
| T |
45551701 |
gccttcaccttattcagaacagatttcttctc |
45551732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University