View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19789_low_3 (Length: 236)
Name: NF19789_low_3
Description: NF19789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19789_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 216
Target Start/End: Complemental strand, 48709585 - 48709390
Alignment:
| Q |
21 |
tttattttttgtaggatgtgtatagttgtttatataattcaataaaaaatttaaaagaggtaagttattttctagttaacatgttaatagttctgtctta |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48709585 |
tttattttgtgtaggatgtgtatagttgtttatataattcaataaaaaatttaaaagaggtaagttattttctagttaacatgttaatagttctgtctta |
48709486 |
T |
|
| Q |
121 |
tagagctcaccgcagcaataggaatttgctttgtagatgaaacatggcattaataatctataatctggatcttcttaactttgctcgattccgtca |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48709485 |
tagagctcaccgcagcaataggaatttcctttgtagatgaaacatgacattcataatctataatctggatcttcttaactttgctcgattccgtca |
48709390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University