View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1978_low_9 (Length: 227)
Name: NF1978_low_9
Description: NF1978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1978_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 12614824 - 12614643
Alignment:
| Q |
30 |
tcatccaactcataaactgaaagttacaggtaaagaatattcttgaaacaaaaaagactaccctaaacaannnnnnnnnnnnnnnnnnnnnnggtttaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12614824 |
tcatccaactcataaactgaaagttacaggtaaagaatattcttgaaacaaaaaagactaccctaaacaatttttttatccttttactttttggtttaca |
12614725 |
T |
|
| Q |
130 |
tagcatcccaaaacagaaaagagaatgatgctttataagttctagacttcaaaaaataaaatgtgaaccaaaagagaataca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12614724 |
tagcatcccaaaacagaaaagagaatgatgctttataagttctagacttcaaaaaataaaatgtgaaccaaaagagaataca |
12614643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University