View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19790_high_3 (Length: 275)
Name: NF19790_high_3
Description: NF19790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19790_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 3 - 236
Target Start/End: Original strand, 2971560 - 2971793
Alignment:
| Q |
3 |
tggcatttttgaaggacatactgtgaacttccaaggccagaagtagctgcatcagtactgcactgacttgaaactccggatgtgaatagatcggtagatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2971560 |
tggcatttttgaaggacatactgtgaacttccaagaccagaagtagctgcatcagtactgcactgacttgaaactccggatgtgaatagatcggtagatg |
2971659 |
T |
 |
| Q |
103 |
aagaagacttggacactgcttgatgaatcattagcatcattagttttagtacttaatcatccaaatgcaaagatagatttaagataacaaacataattgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2971660 |
aagaagacttggacactgcttgatgaatcattagcatcatcagttatagtacttaatcatccaaatgcaaagataggtttaagataacaaacataattgt |
2971759 |
T |
 |
| Q |
203 |
tgagaagattttgcgcacgtgagcaataggtgcc |
236 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
2971760 |
tgagaagattttgcgcatgtgagcaataggtgcc |
2971793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University