View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19790_low_1 (Length: 458)

Name: NF19790_low_1
Description: NF19790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19790_low_1
NF19790_low_1
[»] chr5 (16 HSPs)
chr5 (24-278)||(20425638-20425892)
chr5 (267-444)||(20425908-20426085)
chr5 (23-165)||(8700508-8700650)
chr5 (25-134)||(8578694-8578803)
chr5 (25-134)||(27671845-27671954)
chr5 (23-171)||(38969864-38970007)
chr5 (23-171)||(42940453-42940600)
chr5 (25-171)||(7759145-7759292)
chr5 (25-134)||(19039318-19039427)
chr5 (23-134)||(5198699-5198810)
chr5 (25-134)||(28239872-28239981)
chr5 (25-134)||(28878418-28878527)
chr5 (82-171)||(42938724-42938813)
chr5 (323-398)||(20431388-20431464)
chr5 (71-134)||(30706887-30706950)
chr5 (71-166)||(9764-9859)
[»] chr4 (28 HSPs)
chr4 (23-182)||(41932053-41932211)
chr4 (24-230)||(40887648-40887854)
chr4 (26-171)||(46437881-46438026)
chr4 (297-369)||(5318706-5318778)
chr4 (23-166)||(55405578-55405721)
chr4 (23-156)||(30705740-30705873)
chr4 (25-228)||(21536248-21536451)
chr4 (25-166)||(21019689-21019830)
chr4 (23-171)||(11082450-11082598)
chr4 (23-171)||(50021783-50021931)
chr4 (23-171)||(51684948-51685096)
chr4 (23-182)||(70964-71123)
chr4 (25-134)||(44678120-44678229)
chr4 (23-134)||(50195213-50195324)
chr4 (25-171)||(37020404-37020550)
chr4 (25-134)||(40356555-40356664)
chr4 (25-134)||(41797195-41797304)
chr4 (25-165)||(6179928-6180068)
chr4 (25-165)||(49092214-49092354)
chr4 (23-171)||(50903184-50903332)
chr4 (25-134)||(1307291-1307400)
chr4 (267-311)||(5318663-5318707)
chr4 (25-134)||(30724890-30724999)
chr4 (25-134)||(31423532-31423641)
chr4 (205-270)||(55279770-55279835)
chr4 (25-171)||(49167334-49167479)
chr4 (23-134)||(50276984-50277095)
chr4 (390-442)||(5318777-5318829)
[»] chr1 (20 HSPs)
chr1 (23-257)||(19216719-19216953)
chr1 (23-156)||(47657583-47657716)
chr1 (24-165)||(49856122-49856263)
chr1 (23-156)||(51322486-51322619)
chr1 (24-171)||(45827390-45827537)
chr1 (23-171)||(19523368-19523516)
chr1 (25-151)||(22525804-22525930)
chr1 (23-171)||(23274347-23274495)
chr1 (25-166)||(96185-96326)
chr1 (25-134)||(19157795-19157904)
chr1 (26-134)||(21142794-21142902)
chr1 (26-165)||(35257038-35257177)
chr1 (24-130)||(38122812-38122918)
chr1 (23-130)||(52803733-52803840)
chr1 (25-171)||(47504155-47504301)
chr1 (25-134)||(13638155-13638264)
chr1 (25-134)||(26877485-26877594)
chr1 (25-134)||(3730500-3730609)
chr1 (25-166)||(31781729-31781869)
chr1 (23-107)||(50342220-50342304)
[»] chr8 (21 HSPs)
chr8 (23-155)||(37328507-37328639)
chr8 (24-182)||(45129470-45129628)
chr8 (26-155)||(5678776-5678905)
chr8 (23-171)||(5302405-5302553)
chr8 (25-134)||(15034921-15035030)
chr8 (25-166)||(43213192-43213333)
chr8 (23-171)||(35553408-35553556)
chr8 (25-166)||(39253840-39253981)
chr8 (24-156)||(22499677-22499808)
chr8 (29-140)||(21177419-21177530)
chr8 (25-134)||(42483643-42483752)
chr8 (25-165)||(487857-487997)
chr8 (25-165)||(26661240-26661380)
chr8 (23-171)||(39835509-39835657)
chr8 (40-171)||(39603122-39603253)
chr8 (25-134)||(23658-23767)
chr8 (25-134)||(1054319-1054428)
chr8 (25-134)||(23020442-23020551)
chr8 (25-134)||(34368748-34368856)
chr8 (26-107)||(25859344-25859425)
chr8 (23-134)||(43189753-43189864)
[»] chr6 (12 HSPs)
chr6 (23-165)||(24086903-24087045)
chr6 (26-171)||(6318723-6318868)
chr6 (24-171)||(3381890-3382038)
chr6 (23-230)||(21602215-21602421)
chr6 (24-141)||(2406320-2406437)
chr6 (23-135)||(2406516-2406628)
chr6 (25-134)||(27637541-27637650)
chr6 (25-165)||(6202942-6203082)
chr6 (25-165)||(11689909-11690049)
chr6 (25-134)||(22303023-22303132)
chr6 (25-134)||(30827773-30827882)
chr6 (23-171)||(31769888-31770034)
[»] chr7 (21 HSPs)
chr7 (23-165)||(9492958-9493100)
chr7 (23-168)||(11636469-11636614)
chr7 (24-165)||(36979352-36979493)
chr7 (23-152)||(39462189-39462318)
chr7 (25-166)||(17836762-17836903)
chr7 (23-171)||(37342060-37342207)
chr7 (40-171)||(11633281-11633412)
chr7 (23-134)||(5539444-5539555)
chr7 (28-171)||(19801209-19801352)
chr7 (23-134)||(27451819-27451930)
chr7 (25-134)||(15072426-15072535)
chr7 (25-134)||(42506087-42506196)
chr7 (25-165)||(9369526-9369666)
chr7 (23-171)||(34740550-34740698)
chr7 (25-165)||(48405151-48405291)
chr7 (25-171)||(17461380-17461526)
chr7 (25-171)||(17591688-17591834)
chr7 (25-134)||(35608546-35608655)
chr7 (25-134)||(41882333-41882442)
chr7 (23-165)||(47671297-47671434)
chr7 (40-107)||(13319082-13319149)
[»] chr3 (28 HSPs)
chr3 (23-165)||(30254177-30254319)
chr3 (23-171)||(20352353-20352501)
chr3 (25-171)||(47072282-47072428)
chr3 (23-165)||(48890480-48890622)
chr3 (23-171)||(48564689-48564837)
chr3 (28-166)||(3977479-3977617)
chr3 (25-166)||(4006513-4006654)
chr3 (25-166)||(36129278-36129419)
chr3 (25-134)||(52389680-52389789)
chr3 (23-171)||(41614080-41614228)
chr3 (25-165)||(49142638-49142778)
chr3 (23-166)||(44231532-44231674)
chr3 (25-134)||(46390744-46390853)
chr3 (25-165)||(34047218-34047358)
chr3 (25-165)||(54387918-54388058)
chr3 (24-171)||(49267461-49267608)
chr3 (24-171)||(50215191-50215338)
chr3 (25-166)||(2273175-2273316)
chr3 (38-171)||(17566265-17566398)
chr3 (25-134)||(42902311-42902420)
chr3 (27-134)||(29010794-29010901)
chr3 (97-171)||(42758553-42758627)
chr3 (95-165)||(50757982-50758052)
chr3 (25-134)||(50478928-50479037)
chr3 (81-171)||(16645378-16645468)
chr3 (23-134)||(598667-598777)
chr3 (25-134)||(46700145-46700254)
chr3 (23-66)||(42757937-42757980)
[»] chr2 (16 HSPs)
chr2 (25-171)||(29399725-29399871)
chr2 (25-134)||(22679324-22679433)
chr2 (25-134)||(28470330-28470439)
chr2 (25-134)||(39949283-39949392)
chr2 (23-165)||(40537349-40537490)
chr2 (25-166)||(10827020-10827160)
chr2 (25-134)||(45430533-45430642)
chr2 (25-165)||(3938878-3939018)
chr2 (25-165)||(30495085-30495225)
chr2 (23-134)||(36654624-36654735)
chr2 (25-134)||(5353800-5353909)
chr2 (25-166)||(7188625-7188766)
chr2 (25-134)||(17422277-17422386)
chr2 (25-165)||(43980314-43980454)
chr2 (25-171)||(15833049-15833195)
chr2 (25-134)||(43537859-43537968)
[»] scaffold0180 (1 HSPs)
scaffold0180 (25-134)||(14083-14192)
[»] scaffold0238 (2 HSPs)
scaffold0238 (96-171)||(17162-17237)
scaffold0238 (23-66)||(17243-17286)
[»] scaffold0155 (1 HSPs)
scaffold0155 (121-182)||(11262-11323)


Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 16)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 24 - 278
Target Start/End: Original strand, 20425638 - 20425892
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
20425638 tgtgcctcatgctttgctgatgactttatgtgagaggtagcatacgaagactagcagctttcacaagcccttgggggagatgaccgttactttggatgat 20425737  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagatatctcggactgatggagcagatctgatggtgagacacttag 223  Q
    ||||||||||||||||||||||||||||||||  ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
20425738 gtcgcatgtcttttgcatattccgattgaaggacgaatgttgagccatccaaggaagatatatcggactgatggagcagatctgatggtgagacacttag 20425837  T
224 gtgtgacgcagacgatggcagtgaaaaattgcaatgaagagtatggtttctttag 278  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
20425838 gtgtgacgcaggcgatggcagtgaaaaattgcaatgaagagtatggtttctttag 20425892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 267 - 444
Target Start/End: Original strand, 20425908 - 20426085
Alignment:
267 tggtttctttaggctatggaatctaattacttccttaatataatttcttaatggaacaaaaaggacaatatgttgaccaattgaccacctttagcggttg 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
20425908 tggtttctttaggctatggaatctaattacttccttaatataatttcttaatggaacaaaaaggacaatatgttgaccaattgaccacctttagcagttg 20426007  T
367 atttatggtagctaattaatttcttaatataaaatttacaaagtacaaccttacacaggtaggagagcacatcctcat 444  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||| || || |||||||    
20426008 atttatggtagctaattaatttcttaatataaaacttacaaagtacaaccttacaaaagtaggaaagtacgtcctcat 20426085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 8700650 - 8700508
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||||| |||| |  |||| ||||  |||| || |||| |||||||||||||| | |||||||| ||    
8700650 ctgtgcctcatgctttgctgatgactctatgcgagaggtggcatcctgagaccagcacttttcccatgcccatgggggagatgaccatgactttggagga 8700551  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    |||||| |||||| ||||| ||| |||||||||| | ||||||    
8700550 tgtcgcttgtcttatgcatcttcagattgaagggcggatgttg 8700508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 8578803 - 8578694
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| | || |||||||| |||| ||||||||||||| || || ||||||||||    
8578803 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccaacacctttcacatgcccatgggggagatgactgtgacattggatgatg 8578704  T
125 tcgcatgtct 134  Q
    ||||||||||    
8578703 tcgcatgtct 8578694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 27671954 - 27671845
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||  || || ||||||||||    
27671954 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgattgtgacattggatgatg 27671855  T
125 tcgcatgtct 134  Q
    ||||||||||    
27671854 tcgcatgtct 27671845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 38969864 - 38970007
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||||| |||||| ||||||||||||||||| |  |||| ||||  ||||||| ||||||||||     ||| || || ||||||||    
38969864 ctgtgcctcatgctttgctaatgactctatgcgagaggtagcatcctgagaccagcacttttcacatgcccttgggg-----gactgtgacattggatga 38969958  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||| |||| ||||| ||| |||||||| ||| ||||||| ||||    
38969959 tgtcgcatctcttatgcatcttcagattgaagagtggatgttgagccat 38970007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 42940600 - 42940453
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| ||| ||||| || |||||||||||| |||| |  |||| ||||  ||||||| ||| |||||||||||||| || |||||||||||    
42940600 ctgtgcctcatgccttgttgatg-ctctatgcgagaggtggcatcccgagaccagcacttttcacatgcctttgggggagatgacagtgactttggatga 42940502  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| ||||| ||| |||| | ||| | ||||||| ||||    
42940501 tgtcgcatgtcttatgcatcttcagattaaggggcgtatgttgagccat 42940453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 25 - 171
Target Start/End: Original strand, 7759145 - 7759292
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggg-gagatgaccgttactttggatgat 123  Q
    |||||||||||  ||||||||||| |||||||||||| |||| |  |||| | || |||||||| |||||||||| |||||||| || || |||||||||    
7759145 gtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccatcacctttcacatgcccttggggtgagatgactgtgacattggatgat 7759244  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||||||   |||| |||||||||| ||| | ||||||| ||||    
7759245 gtcgcatgtctcacgcatcttccgattgaggggcggatgttgagccat 7759292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 19039427 - 19039318
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
19039427 gtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 19039328  T
125 tcgcatgtct 134  Q
    ||||||||||    
19039327 tcgcatgtct 19039318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 5198699 - 5198810
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  || |||||||| |||||||||||| |||| |  ||||  |||  ||||||| |||||||||||||||||| || || ||| ||||    
5198699 ctgtgcctcatgccctgttgatgactctatgcgagaggtggcatcccgagacctgcacttttcacatgcccttgggggagatgactgtgaccttgaatga 5198798  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
5198799 tgtcgcatgtct 5198810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 28239981 - 28239872
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || |||||||| |    
28239981 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgaag 28239882  T
125 tcgcatgtct 134  Q
    ||||||||||    
28239881 tcgcatgtct 28239872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 28878418 - 28878527
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| ||||||||||||||||||  ||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||| ||||    
28878418 gtgcctcatgccctgctgctgactttatgcgagaggtgacatccggagaccagcaccttccacatgccgatgggggagatgactgtaacattggacgatg 28878517  T
125 tcgcatgtct 134  Q
    ||||||||||    
28878518 tcgcatgtct 28878527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 82 - 171
Target Start/End: Complemental strand, 42938813 - 42938724
Alignment:
82 tttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||| ||| |||||||||||||| || |||||||||||||||||||||||| ||||| ||| |||| | ||| | ||||||| ||||    
42938813 tttcacatgcctttgggggagatgacagtgactttggatgatgtcgcatgtcttatgcatcttcagattaaggggcgtatgttgagccat 42938724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 323 - 398
Target Start/End: Original strand, 20431388 - 20431464
Alignment:
323 caaaaaggacaatatgt-tgaccaattgaccacctttagcggttgatttatggtagctaattaatttcttaatataa 398  Q
    ||||||||||||| ||| ||||| ||||||||| |||  |  |||||||| ||||||||||||||||||||||||||    
20431388 caaaaaggacaatctgtctgaccgattgaccacttttgacacttgatttaaggtagctaattaatttcttaatataa 20431464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 71 - 134
Target Start/End: Original strand, 30706887 - 30706950
Alignment:
71 agactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtct 134  Q
    |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||||||||||||    
30706887 agaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatgtcgcatgtct 30706950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 9859 - 9764
Alignment:
71 agactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    |||| |||| |||||||| |||| |||||||||||||  | || ||||||||||||||||||    ||||| |||||||||| ||| | |||||||    
9859 agaccagcacctttcacatgcccatgggggagatgactatgacattggatgatgtcgcatgttccatgcatcttccgattgaggggcggatgttga 9764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 28)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 23 - 182
Target Start/End: Complemental strand, 41932211 - 41932053
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||||| |||| |  |||||||||  ||||||| ||| |||||| ||||||| || |||||||||||    
41932211 ctgtgcctcatgctttgctgatgactctatgcgagaggtggcatcctgagactagcacttttcacatgccgttgggg-agatgactgtgactttggatga 41932113  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagat 182  Q
    ||||||||||||| ||||| ||| |||||||||| | ||||||| |||||||| ||||||    
41932112 tgtcgcatgtcttatgcatcttcagattgaagggaggatgttgagccatccaaagaagat 41932053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 24 - 230
Target Start/End: Complemental strand, 40887854 - 40887648
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||||||||| |||||||||||||||||||| ||||||  |||| | ||| ||||||  |||  |||||||||||||| ||||||||||||||    
40887854 tgtgcctcatgctttgccgatgactttatgcgagaggtggcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgat 40887755  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagatatctcggactgatggagcagatctgatggtgagacacttag 223  Q
    ||||||||||| ||| || ||| |||| || ||   ||||||| |||||||| |||| | |||| | || ||||||  ||  |||||| || ||||||||    
40887754 gtcgcatgtctgttgtatcttctgattaaaaggatcatgttgagccatccaaagaaggtgtctcaggcttatggagtggagatgatggcgacacacttag 40887655  T
224 gtgtgac 230  Q
    |||||||    
40887654 gtgtgac 40887648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 26 - 171
Target Start/End: Original strand, 46437881 - 46438026
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgt 125  Q
    ||||||||||||||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| ||||||||||||||||||||| ||||||||||| ||    
46437881 tgcctcatgctttgctgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgaccgtgactttggatgacgt 46437980  T
126 cgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||| |||| ||||| ||| |||||||||| | ||||||| ||||    
46437981 cgcatctcttatgcatcttcagattgaagggcggatgttgagccat 46438026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 297 - 369
Target Start/End: Original strand, 5318706 - 5318778
Alignment:
297 ttccttaatataatttcttaatggaacaaaaaggacaatatgttgaccaattgaccacctttagcggttgatt 369  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5318706 ttccttaatataatttcttaatggaacaaaaaggacaatatgttgaccaattgaccacctttagcagttgatt 5318778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 23 - 166
Target Start/End: Complemental strand, 55405721 - 55405578
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||| ||||||||| | |||||||||||| |||| | ||||| ||||  ||||||| |||||||||| ||||||| || |||||||||||    
55405721 ctgtgcctcatgctctgctgatgattctatgcgagaggtggcatcccaagaccagcacttttcacatgcccttggggaagatgactgtgactttggatga 55405622  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    |||| |||||||| ||||| ||| |||||||||| | |||||||    
55405621 tgtcacatgtcttatgcatcttcagattgaagggcggatgttga 55405578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 30705740 - 30705873
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||||||||||| ||||| ||||||| |||| |  |||| ||||  ||||||| |  ||||||||||||||| || |||||||||||    
30705740 ctgtgcctcatgctttgctgatgacattatgtgagaggtggcatcccgagacgagcacttttcacacggtcttgggggagatgactgtgactttggatga 30705839  T
123 tgtcgcatgtcttttgcatattccgattgaaggg 156  Q
    ||||||||||||| ||||| ||| ||||||||||    
30705840 tgtcgcatgtcttatgcatcttcagattgaaggg 30705873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 21536451 - 21536248
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    ||||||||| ||||||||||||||||| |||||||||  ||  |  |||| || |  ||||||| |  |||||||||||||||  |||||||||||||||    
21536451 gtgcctcatactttgctgatgactttaagcgagaggtgacaccccgagacgagtagttttcacatggtcttgggggagatgactattactttggatgatg 21536352  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagatatctcggactgatggagcagatctgatggtgagacacttagg 224  Q
    || || |||||  |||| |||||||||||||| | ||||||| |||||| | |||||| |||||   ||| ||||| || ||||||||||| ||||||||    
21536351 tcacaagtcttacgcatcttccgattgaagggcggatgttgagccatccgaagaagatttctcgacatgagggagcggaactgatggtgaggcacttagg 21536252  T
225 tgtg 228  Q
    ||||    
21536251 tgtg 21536248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 21019830 - 21019689
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
21019830 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 21019731  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
21019730 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 21019689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 11082598 - 11082450
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| ||||||||||| ||||||||||||| |||| |   ||| ||||  ||||||| |  ||||||||||||||| || |||||||||||    
11082598 ctgtgcctcatgcgttgctgatgacattatgcgagaggtggcatcccgcgaccagcagttttcacatggtcttgggggagatgactgtgactttggatga 11082499  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||||| || ||||| ||| |||||||||| | ||||||| ||||    
11082498 tgtcgcatgtattatgcatcttcagattgaagggcggatgttgagccat 11082450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 50021931 - 50021783
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||| | ||||||||||| |||||||||||| ||||    |||| | ||  ||||||| |||||||||||||||||| || | |||||||||    
50021931 ctgtgcctcatgatctgctgatgactctatgcgagaggtggcatctcgagaccaacacttttcacatgcccttgggggagatgactgtgattttggatga 50021832  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| ||||| ||| |||||| ||||| ||||||| ||||    
50021831 tgtcgcatgtcttatgcatcttcagattgaggggtggatgttgagccat 50021783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 51684948 - 51685096
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  || |||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || |||||||||||    
51684948 ctgtgcctcatgccctgttgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatga 51685047  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||| |||||||| ||||| ||| |||||| ||| | ||||||| ||||    
51685048 tgtcacatgtcttatgcatcttcagattgaggggcggatgttgagccat 51685096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 70964 - 71123
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||| |||||||  ||| |  |||| | ||  ||||||| |||| ||||||||||||| || |||||||||||    
70964 ctgtgcctcatgctttgctgatgactctatgtgagaggtgacatcccgagaccaacacttttcacatgcccatgggggagatgactgtgactttggatga 71063  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagat 182  Q
    ||| |||| |||| ||||| ||| |||||||||| | ||||||  ||||| || ||||||    
71064 tgttgcatatcttatgcatcttcagattgaagggcggatgttgggccatcgaaagaagat 71123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 44678229 - 44678120
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| |||||||||||| |||| |  |||| |||| |||||||| ||||||||||||||| || || || ||||||||||    
44678229 gtgcctcatgccctgctgatgactctatgcgagaggtggcatcctgagaccagcacctttcacatgcccttgggggagataactgtgacattggatgatg 44678130  T
125 tcgcatgtct 134  Q
    ||||||||||    
44678129 tcgcatgtct 44678120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 50195213 - 50195324
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| |||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || || || |||||    
50195213 ctgtgcctcatgccttgctgatgactctatgcgagaggtggcatcccgagaccatcacttttcacatgcccttgggggagatgactgtgaccttagatga 50195312  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
50195313 tgtcgcatgtct 50195324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 25 - 171
Target Start/End: Complemental strand, 37020550 - 37020404
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| ||| | |||||| |||| |  |||| |||| |||||||| | |||||||||||||||| || || ||||||||||    
37020550 gtgcctcatgccctgctgatgactctatacaagaggtggcatcccgagaccagcacctttcacatgtccttgggggagatgactgtgacattggatgatg 37020451  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    | ||||||||   ||||||||||||||| ||| | ||||||| ||||    
37020450 ttgcatgtctcacgcatattccgattgaggggcggatgttgagccat 37020404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 40356664 - 40356555
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||||||| |||||||| |||| || |||| |||| |||||||| |||| ||||||||||| |  | || ||||||||||    
40356664 gtgcctcatgccctgctgatgactttatacgagaggtggcatccggagaccagcacctttcacatgcccatgggggagatgtctatgacattggatgatg 40356565  T
125 tcgcatgtct 134  Q
    ||||||||||    
40356564 tcgcatgtct 40356555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 41797304 - 41797195
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
41797304 gtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 41797205  T
125 tcgcatgtct 134  Q
    ||||||||||    
41797204 tcgcatgtct 41797195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 6180068 - 6179928
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
6180068 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 6179969  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
6179968 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 6179928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 49092214 - 49092354
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
49092214 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 49092313  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
49092314 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 49092354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 50903184 - 50903332
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||| |||||||  ||| |  |||| | ||  ||||||| |||||||||||||||||  || |||||||||||    
50903184 ctgtgcctcatgccctgctgatgactctatgtgagaggtgacatcccgagaccaacacttttcacatgcccttgggggagatgatagtgactttggatga 50903283  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| ||||| ||  |||||| ||| | ||||||| ||||    
50903284 tgtcgcatgtcttatgcatctttagattgaggggcggatgttgagccat 50903332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 1307400 - 1307291
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
1307400 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 1307301  T
125 tcgcatgtct 134  Q
    ||||||||||    
1307300 tcgcatgtct 1307291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 311
Target Start/End: Original strand, 5318663 - 5318707
Alignment:
267 tggtttctttaggctatggaatctaattacttccttaatataatt 311  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
5318663 tggtttctttaggctatggaatctaattacttccttaatataatt 5318707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 30724999 - 30724890
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| | || ||| |||| |||  ||||||||||||| || || |||||||||     
30724999 gtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccaacaccttccacatgccgatgggggagatgactgtgacattggatgatt 30724900  T
125 tcgcatgtct 134  Q
    ||||||||||    
30724899 tcgcatgtct 30724890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 31423532 - 31423641
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| |  || ||||||||||    
31423532 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgcgacattggatgatg 31423631  T
125 tcgcatgtct 134  Q
    ||||||||||    
31423632 tcgcatgtct 31423641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 205 - 270
Target Start/End: Complemental strand, 55279835 - 55279770
Alignment:
205 ctgatggtgagacacttaggtgtgacgcagacgatggcagtgaaaaattgcaatgaagagtatggt 270  Q
    ||||||| ||||||||||| |||||||| | ||  |||||||||||||||||||||||||||||||    
55279835 ctgatggagagacacttagatgtgacgcgggcggaggcagtgaaaaattgcaatgaagagtatggt 55279770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 25 - 171
Target Start/End: Original strand, 49167334 - 49167479
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||| ||||||| || || ||||||||||    
49167334 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggg-agatgactgtgacattggatgatg 49167432  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| |||| ||||| ||| | |||||| |||||    
49167433 tcgcatgtctcacgcatcttcctattgaggggcggatgttggaccat 49167479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 50276984 - 50277095
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||| |||||||  ||||||||||| |||||||||||| | ||    |||| ||||  |||||||  |||||| |||||||||| || || ||||||||    
50276984 ctgtgtctcatgccctgctgatgactctatgcgagaggtggtatctcgagaccagcacatttcacattcccttgagggagatgactgtgaccttggatga 50277083  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
50277084 tgtcgcatgtct 50277095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 390 - 442
Target Start/End: Original strand, 5318777 - 5318829
Alignment:
390 ttaatataaaatttacaaagtacaaccttacacaggtaggagagcacatcctc 442  Q
    ||||||||||| |||||||||||||||||| ||| |||||| ||||| |||||    
5318777 ttaatataaaacttacaaagtacaaccttagacaagtaggaaagcacgtcctc 5318829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 79; Significance: 9e-37; HSPs: 20)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 23 - 257
Target Start/End: Original strand, 19216719 - 19216953
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||| ||||||||||||||||| ||| ||||||  |||| | ||  ||||||   ||  || |||||||||| ||||||||||||||    
19216719 ctgtgcctcatgctttgatgatgactttatgcgagcggtggcataccgagaccaacatttttcactttcctgtgagggagatgacggttactttggatga 19216818  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagatatctcggactgatggagcagatctgatggtgagacactta 222  Q
    ||||  |||||| ||||||||||| |||||||||   ||||||| |||||||| |||| | |||| | ||||||||   || ||||||||||||||||||    
19216819 tgtcagatgtctgttgcatattcccattgaagggatcatgttgagccatccaaagaaggtgtctcaggctgatggattggagctgatggtgagacactta 19216918  T
223 ggtgtgacgcagacgatggcagtgaaaaattgcaa 257  Q
    |||||||| ||| |   ||| ||||||||||||||    
19216919 ggtgtgacacaggctgaggctgtgaaaaattgcaa 19216953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 47657583 - 47657716
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| ||||||||||||||||| |  |||| | ||  ||||||| |||||||||||||||||| || |||||||||||    
47657583 ctgtgcctcatgctttgctgatgactctatgcgagaggtagcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatga 47657682  T
123 tgtcgcatgtcttttgcatattccgattgaaggg 156  Q
    |||||||| |||| ||||| ||  ||||||||||    
47657683 tgtcgcatctcttatgcatctttagattgaaggg 47657716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 24 - 165
Target Start/End: Complemental strand, 49856263 - 49856122
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||| ||||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||| |||||||||||||||| |||||||| |||    
49856263 tgtgcctcatgttttgctgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccatgggggagatgaccgtgactttggaggat 49856164  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    |||||||||||| ||||| ||| |||||||||| ||||||||    
49856163 gtcgcatgtcttatgcatcttcagattgaagggcgaatgttg 49856122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 51322486 - 51322619
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||| | |||| | ||||| ||||  ||||||| || | |||||||||||||||| |||||||| ||    
51322486 ctgtgcctcatgctttgctgatgactctatgcgagagatggcatcctaagaccagcacttttcacatgctcatgggggagatgaccgtgactttggagga 51322585  T
123 tgtcgcatgtcttttgcatattccgattgaaggg 156  Q
    ||||||||||||| ||||| ||| ||||||||||    
51322586 tgtcgcatgtcttatgcatcttcagattgaaggg 51322619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 24 - 171
Target Start/End: Original strand, 45827390 - 45827537
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||||| ||||||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || ||||||||||||    
45827390 tgtgcctcatgctctgctgatgactctatgcgagaggtggcatcctgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgat 45827489  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||| |||| ||||| ||| |||||| ||| | ||||||| ||||    
45827490 gtcgcatatcttatgcatcttcagattgaggggcggatgttgagccat 45827537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 19523516 - 19523368
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| |||| || |||| |||| |||||||| |||||||||||||||||| || |  ||||||||    
19523516 ctgtgcctcatgccgtgctgatgactctatgcgagaggtggcatccggagaccagcacctttcacatgcccttgggggagatgactgtgatcttggatga 19523417  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||   |||| ||| |||||| ||| | ||||||| ||||    
19523416 tgtcgcatgtctgacgcatcttcagattgaggggcggatgttgacccat 19523368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 25 - 151
Target Start/End: Original strand, 22525804 - 22525930
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| ||| ||||||||||| || || || ||||||||||    
22525804 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcctttgggggagataactgtgacattggatgatg 22525903  T
125 tcgcatgtcttttgcatattccgattg 151  Q
    ||||||||||  ||||| |||||||||    
22525904 tcgcatgtctcatgcatcttccgattg 22525930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 23274495 - 23274347
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  |  |||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || |||||||||||    
23274495 ctgtgcctcatgccctaatgatgactctatgcgagaggtggcatcctgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatga 23274396  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| ||||| ||| |||||| ||| | ||||||| ||||    
23274395 tgtcgcatgtcttatgcatcttcagattgaggggcggatgttgagccat 23274347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 96326 - 96185
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||| ||||||| ||||||||||| |||||||||||| |||| |  |||| |||| |||||||| |||||| ||||||||||| || || ||||||||||    
96326 gtgcttcatgctctgctgatgactctatgcgagaggtggcatcctgagaccagcacctttcacatgccctttggggagatgactgtgacattggatgatg 96227  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    | ||||||||   |||| |||||||||| ||| | |||||||    
96226 ttgcatgtctcacgcatcttccgattgaggggcggatgttga 96185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 19157795 - 19157904
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||| ||||||| || || ||||||||||    
19157795 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatggggaagatgactgtgacattggatgatg 19157894  T
125 tcgcatgtct 134  Q
    ||||||||||    
19157895 tcgcatgtct 19157904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 26 - 134
Target Start/End: Original strand, 21142794 - 21142902
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgt 125  Q
    ||||||||||  ||||||||||| ||| |||||||| |||| |  |||| |||| |||||||| |||||||||||||||||| || || |||||||||||    
21142794 tgcctcatgccctgctgatgactctatacgagaggtggcatcccgagaccagcacctttcacatgcccttgggggagatgactgtgaccttggatgatgt 21142893  T
126 cgcatgtct 134  Q
    |||||||||    
21142894 cgcatgtct 21142902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 26 - 165
Target Start/End: Complemental strand, 35257177 - 35257038
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgt 125  Q
    |||||| ||||||||||||| || |||||||||||| |||| |  |||| | ||  ||||||| |||| ||||||||||||  || |||||||| |||||    
35257177 tgcctcgtgctttgctgatggctctatgcgagaggtggcatcccgagaccatcacttttcacatgcccatgggggagatgattgtgactttggaggatgt 35257078  T
126 cgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    |||||||||| ||||| ||| |||||||||| | ||||||    
35257077 cgcatgtcttatgcatcttctgattgaagggcggatgttg 35257038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 38122918 - 38122812
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||||||||  ||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || ||||||||||||    
38122918 tgtgcctcatgctttgtcgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgat 38122819  T
124 gtcgcat 130  Q
    |||||||    
38122818 gtcgcat 38122812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 23 - 130
Target Start/End: Original strand, 52803733 - 52803840
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||| | ||||||||||||  ||| | ||||| |||| |||||||| |||||||||||||||||  || || ||||||||    
52803733 ctgtgcctcatgccctgctgatgattctatgcgagaggtgacatcccaagaccagcacctttcacatgcccttgggggagatgattgtgaccttggatga 52803832  T
123 tgtcgcat 130  Q
    ||||||||    
52803833 tgtcgcat 52803840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 171
Target Start/End: Original strand, 47504155 - 47504301
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| |||| ||||||| |||| |  |||| ||||  ||||||| |||||| ||||||||||| || || ||||||||||    
47504155 gtgcctcatgccctgctgatgactctatgagagaggtggcatcccgagaccagcacttttcacatgcccttaggggagatgactgtgaccttggatgatg 47504254  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| ||| |||||| ||| | ||||||| ||||    
47504255 tcgcatgtctgacgcatcttcagattgaggggcggatgttgagccat 47504301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 13638264 - 13638155
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
13638264 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 13638165  T
125 tcgcatgtct 134  Q
    ||||||||||    
13638164 tcgcatgtct 13638155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 26877485 - 26877594
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
26877485 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 26877584  T
125 tcgcatgtct 134  Q
    ||||||||||    
26877585 tcgcatgtct 26877594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 3730609 - 3730500
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | ||| |||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
3730609 gtgcctcatgccctgctgcttactatatgcgagaggtggcatccggagaccagcagcttccacatgccgatgggggagatgactgtgacattggatgatg 3730510  T
125 tcgcatgtct 134  Q
    ||||||||||    
3730509 tcgcatgtct 3730500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 31781869 - 31781729
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  || ||||||||||||||||||||| |||| |  |||| ||||  ||||||| |||| ||||||||||||   | || ||||||||||    
31781869 gtgcctcatgccctgttgatgactttatgcgagaggtggcatcctgagaccagcacatttcacatgcccatgggggagatga-tatgacattggatgatg 31781771  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
31781770 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 31781729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 23 - 107
Target Start/End: Complemental strand, 50342304 - 50342220
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgac 107  Q
    |||||||||||||  | ||||||||| |||||||||||| |||| | ||||| || |  ||||||| ||||||||||||||||||    
50342304 ctgtgcctcatgccctactgatgactctatgcgagaggtggcatcccaagaccagtacttttcacatgcccttgggggagatgac 50342220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 73; Significance: 4e-33; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 23 - 155
Target Start/End: Original strand, 37328507 - 37328639
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || |||||||||||    
37328507 ctgtgcctcatgctttgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatga 37328606  T
123 tgtcgcatgtcttttgcatattccgattgaagg 155  Q
    |||||||| |||| ||||| ||| |||||||||    
37328607 tgtcgcatctcttatgcatcttcagattgaagg 37328639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 24 - 182
Target Start/End: Original strand, 45129470 - 45129628
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    |||| |||||||||||||||||||| |||| ||||||| |||| |  ||||  |||  ||||||| ||| |||||||||||||  || ||||||||||||    
45129470 tgtgtctcatgctttgctgatgactctatgtgagaggtggcatcccgagaccggcacttttcacatgccattgggggagatgattgtgactttggatgat 45129569  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagat 182  Q
    |||||||||||| ||||| ||| |||||||||| | ||||||| |||||||| ||||||    
45129570 gtcgcatgtcttatgcatgttcagattgaagggcggatgttgagccatccaaagaagat 45129628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 26 - 155
Target Start/End: Original strand, 5678776 - 5678905
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgt 125  Q
    ||||||||||||||||||||||| ||| |||||||| |||| |  |||  ||||  ||||||| ||||||||||||||||||||||||| ||||||||||    
5678776 tgcctcatgctttgctgatgactctatacgagaggtggcatcccgagagcagcacttttcacatgcccttgggggagatgaccgttactctggatgatgt 5678875  T
126 cgcatgtcttttgcatattccgattgaagg 155  Q
    | ||||||||  |||| ||| |||||||||    
5678876 ctcatgtcttacgcatcttcagattgaagg 5678905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 5302553 - 5302405
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| |||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| ||||||||||||||||||  | |||||||||||    
5302553 ctgtgcctcatgccttgctgatgactctatgcgagaggtggcatcccgagaccatcacttttcacatgcccttgggggagatgactatgactttggatga 5302454  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| || || ||| |||||| ||| | ||||||| ||||    
5302453 tgtcgcatgtcttatgtatcttcagattgaggggcggatgttgagccat 5302405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 15035030 - 15034921
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
15035030 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 15034931  T
125 tcgcatgtct 134  Q
    ||||||||||    
15034930 tcgcatgtct 15034921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 43213192 - 43213333
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
43213192 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 43213291  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    | ||||||||   |||| |||||||||| ||| | |||||||    
43213292 ttgcatgtctcacgcatcttccgattgaggggcggatgttga 43213333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 35553408 - 35553556
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||| |||||||| ||||||| |||| |||| |  |||| ||||  ||||||| ||| |||||||||||||| || |||||||||||    
35553408 ctgtgcctcatgctttgttgatgactctatgcgaaaggtggcatcccgagaccagcacttttcacatgcctttgggggagatgactgtgactttggatga 35553507  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||| |||| ||| | |||  ||||||||| | ||||||| ||||    
35553508 tgtcgcatctcttatgcttcttcaaattgaagggcggatgttgagccat 35553556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 39253840 - 39253981
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  | |||||||||||||||||||||| |||| |  |||| |||| |||||||| || | ||||||||||||| || || ||||||||||    
39253840 gtgcctcatgccctactgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcacatgggggagatgactgtgacattggatgatg 39253939  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
39253940 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 39253981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 24 - 156
Target Start/End: Original strand, 22499677 - 22499808
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    |||||||||||||||||| |||||||| |||||||||| ||||||  |||| | ||  ||||||  |||  | |||||||||||| ||||||||||||||    
22499677 tgtgcctcatgctttgct-atgactttgtgcgagaggtggcatactgagaccaacagatttcacttgcctgtaggggagatgaccattactttggatgat 22499775  T
124 gtcgcatgtcttttgcatattccgattgaaggg 156  Q
     |||| ||||| ||||||||||| |||||||||    
22499776 atcgcctgtctattgcatattcccattgaaggg 22499808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 29 - 140
Target Start/End: Complemental strand, 21177530 - 21177419
Alignment:
29 ctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgc 128  Q
    |||||| ||||||||||||  |||||||||| | |||| |  |||| ||||  ||||||| |||||||||||||||||| || |||||||||||||||||    
21177530 ctcatgttttgctgatgacgctatgcgagagttggcatcccgagacaagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgc 21177431  T
129 atgtcttttgca 140  Q
    ||||||| ||||    
21177430 atgtcttatgca 21177419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 42483752 - 42483643
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    ||||||||||| |||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
42483752 gtgcctcatgccttgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 42483653  T
125 tcgcatgtct 134  Q
    ||||||||||    
42483652 tcgcatgtct 42483643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 487997 - 487857
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
487997 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcatcttccacatgccgatgggggagatgactgtgacattggatgatg 487898  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
487897 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 487857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 26661240 - 26661380
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
26661240 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 26661339  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
26661340 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 26661380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 39835657 - 39835509
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||| ||||  ||||||||||| |||||||||| | |||| |  |||| ||||  ||||||| |||||||||||||||||  || || ||||||||    
39835657 ctgtgccttatgccctgctgatgactctatgcgagagatggcatcccgagaccagcacttttcacatgcccttgggggagatgattgtcaccttggatga 39835558  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||   |||| ||| |||||| ||||| ||||||| ||||    
39835557 tgtcgcatgtctgacgcatcttcagattgaggggtggatgttgagccat 39835509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 40 - 171
Target Start/End: Original strand, 39603122 - 39603253
Alignment:
40 ctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtcttttgc 139  Q
    ||||||||| ||||||||| || |||| |  |||| |||| |||||||| |||||||||||||||||| || || ||||||||||||||||||||    |    
39603122 ctgatgactctatgcgagatgtggcatcccgagaccagcacctttcacatgcccttgggggagatgactgtgacattggatgatgtcgcatgtctcacac 39603221  T
140 atattccgattgaagggtgaatgttgaaccat 171  Q
    || |||||||||| ||| | ||||||| ||||    
39603222 atcttccgattgaggggcggatgttgagccat 39603253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 23767 - 23658
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
23767 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcagcttccacatgccgatgggggagatgactgtgacattggatgatg 23668  T
125 tcgcatgtct 134  Q
    ||||||||||    
23667 tcgcatgtct 23658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 1054319 - 1054428
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
1054319 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 1054418  T
125 tcgcatgtct 134  Q
    ||||||||||    
1054419 tcgcatgtct 1054428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 23020551 - 23020442
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
23020551 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 23020452  T
125 tcgcatgtct 134  Q
    ||||||||||    
23020451 tcgcatgtct 23020442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 34368856 - 34368748
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| |||||||||||| |||| |  |||| |||| |||||||| |||||| ||||||||||| || || ||||||||||    
34368856 gtgcctcatgccctgctgatgactctatgcgagaggtggcatcctgagaccagcacctttcacatgccctt-ggggagatgactgtgacattggatgatg 34368758  T
125 tcgcatgtct 134  Q
    | ||||||||    
34368757 ttgcatgtct 34368748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 107
Target Start/End: Complemental strand, 25859425 - 25859344
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgac 107  Q
    ||||||||||  ||||||||||| |||||||||||| |||| | ||||| ||||  ||||||| ||||||||||||||||||    
25859425 tgcctcatgccctgctgatgactctatgcgagaggtcgcatcccaagaccagcacttttcacatgcccttgggggagatgac 25859344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 43189753 - 43189864
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||| ||||  | ||||||||| | |||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || || ||||||||    
43189753 ctgtgcctaatgccctactgatgactctgtgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgaccttggatga 43189852  T
123 tgtcgcatgtct 134  Q
    ||||| ||||||    
43189853 tgtcgtatgtct 43189864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 12)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 24087045 - 24086903
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||||| || | |  | || ||||  ||||||| |||| |||||||||||||||| |||||||| ||    
24087045 ctgtgcctcatgctttgctgatgactctatgcgagaggtggcttcccgaaaccagcacttttcacatgcccatgggggagatgaccgtgactttggagga 24086946  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||||| ||||| ||| |||||||||| | ||||||    
24086945 tgtcgcatgtcttatgcatcttcagattgaagggcggatgttg 24086903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 26 - 171
Target Start/End: Complemental strand, 6318868 - 6318723
Alignment:
26 tgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgt 125  Q
    ||||||||||| | ||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || ||||||||||||||    
6318868 tgcctcatgctctactgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgt 6318769  T
126 cgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||||| ||||| ||| |||||||||| | ||||||| ||||    
6318768 cgcatgtcttatgcatcttcagattgaagggaggatgttgagccat 6318723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 24 - 171
Target Start/End: Original strand, 3381890 - 3382038
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggg-gagatgaccgttactttggatga 122  Q
    |||| ||||||||||||| ||||| ||||||||||||| |||| |  ||||||||| |||||||| |  ||||||| |||||||  || |||||||||||    
3381890 tgtgtctcatgctttgctaatgacattatgcgagaggtggcatcccgagactagcagctttcacacggtcttggggggagatgattgtgactttggatga 3381989  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||| ||||| ||| |||||||||| | ||||||| ||||    
3381990 tgtcgcatgtcttatgcatcttcagattgaagggcggatgttgagccat 3382038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 21602215 - 21602421
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||||  |||||| |||| ||||||| |||| |  |||| ||||  ||||||  | |||  |||||||||||| ||||||| |||||    
21602215 ctgtgcctcatgctttgcatatgactctatgtgagaggtggcatgccgagaccagcagttttcacttg-cctgtggggagatgaccattacttttgatga 21602313  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagatatctcggactgatggagcagatctgatggtgagacactta 222  Q
    ||| |  ||||| |||||| ||||||||||||||  |||||| | |||||||| |||| | |||| | |||||||||  |||||||  ||||||||||||    
21602314 tgttgtctgtctgttgcatcttccgattgaagggcaaatgttaagccatccaaagaaggtgtctcaggctgatggagtggatctgaatgtgagacactta 21602413  T
223 ggtgtgac 230  Q
    ||||||||    
21602414 ggtgtgac 21602421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 24 - 141
Target Start/End: Original strand, 2406320 - 2406437
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||||  ||| ||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || ||||||||||||    
2406320 tgtgcctcatgccctgcagatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgat 2406419  T
124 gtcgcatgtcttttgcat 141  Q
    |||||||||||| |||||    
2406420 gtcgcatgtcttatgcat 2406437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 135
Target Start/End: Complemental strand, 2406628 - 2406516
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||| ||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || |||||||||||    
2406628 ctgtgcctcatgccctgcagatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatga 2406529  T
123 tgtcgcatgtctt 135  Q
    |||||||||||||    
2406528 tgtcgcatgtctt 2406516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 27637541 - 27637650
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
27637541 gtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 27637640  T
125 tcgcatgtct 134  Q
    ||||||||||    
27637641 tcgcatgtct 27637650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 6202942 - 6203082
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
6202942 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 6203041  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
6203042 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 6203082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 11689909 - 11690049
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
11689909 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 11690008  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
11690009 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 11690049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 22303023 - 22303132
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
22303023 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 22303122  T
125 tcgcatgtct 134  Q
    ||||||||||    
22303123 tcgcatgtct 22303132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 30827882 - 30827773
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
30827882 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 30827783  T
125 tcgcatgtct 134  Q
    ||||||||||    
30827782 tcgcatgtct 30827773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 31769888 - 31770034
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |  ||||||||| |||| |  |||| | || |||||||| ||||||| |||||||||| || || ||||||||    
31769888 ctgtgcctcatgccatgctgatgactct--gcgagaggtggcatcccgagaccaacacctttcacatgcccttgtgggagatgactgtgaccttggatga 31769985  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||   |||| ||| |||||| ||| | ||||||| ||||    
31769986 tgtcgcatgtctcacgcatcttcagattgaggggcggatgttgagccat 31770034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 3e-27; HSPs: 21)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 9493100 - 9492958
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||||||||||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||| || ||||||||||||| |||||||| ||    
9493100 ctgtgcctcatgctttgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccatgagggagatgaccgtgactttggagga 9493001  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||| ||||||| ||||| ||| ||| |||||| | ||||||    
9493000 tgtcgtatgtcttatgcatcttcagatggaagggcggatgttg 9492958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 23 - 168
Target Start/End: Original strand, 11636469 - 11636614
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||   |||||||||||||||||||| || |||| |  |||| ||||  ||||||| |||||||||||||||||| || |||||||||||    
11636469 ctgtgcctcatgcccggctgatgactttatgcgagatgtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatga 11636568  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaac 168  Q
    ||||||||||||| ||||| ||  |||||| ||| | |||||||||    
11636569 tgtcgcatgtcttatgcatctttagattgaggggcggatgttgaac 11636614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 24 - 165
Target Start/End: Original strand, 36979352 - 36979493
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||| |||||| |||||| ||||||||||||  ||| | ||||| ||||  | ||||| |||| |||||||||||||||| |||||||| |||    
36979352 tgtgcctcatgttttgctaatgactctatgcgagaggtgacatcctaagaccagcacttctcacatgcccatgggggagatgaccgtgactttggaggat 36979451  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    |||||||||||| ||||| ||| |||||||||| | ||||||    
36979452 gtcgcatgtcttatgcatcttcagattgaagggcggatgttg 36979493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 23 - 152
Target Start/End: Original strand, 39462189 - 39462318
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||||||||||| || || ||||||||    
39462189 ctgtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgaccttggatga 39462288  T
123 tgtcgcatgtcttttgcatattccgattga 152  Q
    ||||||||||||| ||||| ||| ||||||    
39462289 tgtcgcatgtcttatgcatcttcagattga 39462318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 17836762 - 17836903
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
17836762 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 17836861  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    || |||||||   |||| |||||||||| ||| | |||||||    
17836862 tcacatgtctcacgcatcttccgattgaggggcggatgttga 17836903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 37342060 - 37342207
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||| |||||||| |||||||||||| |||| |  |||| || |  ||||||| |||||||||| ||||||| || |||||||||||    
37342060 ctgtgcctcatgctttgatgatgactctatgcgagaggtggcatcccgagaccag-acttttcacatgcccttggggaagatgactgtgactttggatga 37342158  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||| || | ||||| ||| |||||||||| | ||||||| ||||    
37342159 tgtcgcatctcgtatgcatcttcagattgaagggcggatgttgagccat 37342207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 40 - 171
Target Start/End: Complemental strand, 11633412 - 11633281
Alignment:
40 ctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtcttttgc 139  Q
    ||||||||| |||||||||||||||||    |||| | ||  ||||||| |||||||||||||||||| || |||||||||||||||||||||||| |||    
11633412 ctgatgactctatgcgagaggtagcatctcgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtcttatgc 11633313  T
140 atattccgattgaagggtgaatgttgaaccat 171  Q
    || ||| |||||| ||| | ||||||| ||||    
11633312 atcttcagattgaggggcggatgttgagccat 11633281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 5539555 - 5539444
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| || | |  |||| | || |||||||| |||||||||||||||||| || || ||||||||    
5539555 ctgtgcctcatgccctgctgatgactctatgcgagaggtggcttcccgagaccaacatctttcacatgcccttgggggagatgactgtgaccttggatga 5539456  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
5539455 tgtcgcatgtct 5539444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 28 - 171
Target Start/End: Original strand, 19801209 - 19801352
Alignment:
28 cctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcg 127  Q
    ||||||||  ||||||||||| |||||||||||| |||| |  |||| ||||  |||||||  ||||||||||||||||| || || |||||||||||||    
19801209 cctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatacccttgggggagatgactgtgaccttggatgatgtcg 19801308  T
128 catgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||   |||| ||| |||||| ||| ||||||||| ||||    
19801309 catgtctgacgcatcttcagattgaggggcgaatgttgagccat 19801352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 27451930 - 27451819
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || || ||||||||    
27451930 ctgtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgacattggatga 27451831  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
27451830 tgtcgcatgtct 27451819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 15072535 - 15072426
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
15072535 gtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 15072436  T
125 tcgcatgtct 134  Q
    ||||||||||    
15072435 tcgcatgtct 15072426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 42506196 - 42506087
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
42506196 gtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 42506097  T
125 tcgcatgtct 134  Q
    ||||||||||    
42506096 tcgcatgtct 42506087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 9369666 - 9369526
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
9369666 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 9369567  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
9369566 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 9369526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 34740550 - 34740698
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  |||||||||||  ||||||||||| |||| |  |||| |||| |||||||| || ||||||||||||||  || || ||||||||    
34740550 ctgtgcctcatgccctgctgatgactccatgcgagaggtggcatcccgagaccagcacctttcacatgctcttgggggagatgattgtgaccttggatga 34740649  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||   |||| ||| |||||| ||| | ||||||| ||||    
34740650 tgtcgcatgtctgacgcatcttcagattgaggggcggatgttgagccat 34740698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 48405151 - 48405291
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
48405151 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 48405250  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
48405251 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 48405291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 171
Target Start/End: Complemental strand, 17461526 - 17461380
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
17461526 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 17461427  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| |||| ||||| ||| | |||||| |||||    
17461426 tcgcatgtctcacgcatcttcctattgaggggcggatgttggaccat 17461380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 171
Target Start/End: Original strand, 17591688 - 17591834
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
17591688 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 17591787  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| |||| ||||| ||| | |||||| |||||    
17591788 tcgcatgtctcacgcatcttcctattgaggggcggatgttggaccat 17591834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 35608655 - 35608546
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
35608655 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 35608556  T
125 tcgcatgtct 134  Q
    ||||||||||    
35608555 tcgcatgtct 35608546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 41882333 - 41882442
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
41882333 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 41882432  T
125 tcgcatgtct 134  Q
    ||||||||||    
41882433 tcgcatgtct 41882442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 47671434 - 47671297
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||| ||||||||||||||||||||     |||||||| |||| |  |||| | ||  ||||||| |||| |||||||||||| ||| |||||||| ||    
47671434 ctgtgtctcatgctttgctgatgact-----cgagaggtggcatcccgagaccaacacttttcacatgcccatgggggagatgatcgtgactttggagga 47671340  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||||| ||||| |||   |||||||| ||||||||    
47671339 tgtcgcatgtcttatgcatcttcatgttgaagggcgaatgttg 47671297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 40 - 107
Target Start/End: Original strand, 13319082 - 13319149
Alignment:
40 ctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgac 107  Q
    ||||||||| |||||||||||| |||| |  |||| |||| |||||||| ||||||||||||||||||    
13319082 ctgatgactctatgcgagaggtggcatcccgagaccagcacctttcacatgcccttgggggagatgac 13319149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 63; Significance: 3e-27; HSPs: 28)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 30254319 - 30254177
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||||| |||||| |||||||||||| |||| |  |||| ||||  ||||||| |||| |||||||||||||| | |||||||| ||    
30254319 ctgtgcctcatgctttgctaatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccatgggggagatgaccatgactttggagga 30254220  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||||| | ||| ||| |||||||||| | ||||||    
30254219 tgtcgcatgtcttatccatcttcagattgaagggcggatgttg 30254177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 20352353 - 20352501
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| ||||| |||||| |||||||||||| | || |   ||||||||  ||||||| |||||||||||||||||| || |||||||||||    
20352353 ctgtgcctcatgccttgctaatgactctatgcgagaggtggtatcccgtgactagcacttttcacatgcccttgggggagatgactgtgactttggatga 20352452  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||| |||||| ||||| ||| |||||| ||| | ||||||| ||||    
20352453 tgtcgcgtgtcttatgcatcttcagattgaggggcggatgttgagccat 20352501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 25 - 171
Target Start/End: Complemental strand, 47072428 - 47072282
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| |||||||||||| |||| |  |||| |||| | |||||| |||||||||||||||||| || || ||||||||||    
47072428 gtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcaccattcacatgcccttgggggagatgactgtgacattggatgatg 47072329  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| |||||||||| ||| | ||||||| ||||    
47072328 tcgcatgtctcacgcatcttccgattgaggggcggatgttgagccat 47072282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 23 - 165
Target Start/End: Original strand, 48890480 - 48890622
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||||||| |||||||| ||||| |||||| |||| | ||||||||||  |||  || |||| ||| |||||||||||| |||||||| ||    
48890480 ctgtgcctcatgctttgttgatgactctatgcaagaggtggcatcccaagactagcacattttgcatgcccatggaggagatgaccgtgactttggagga 48890579  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||||| |||||  || |||||||||| | ||||||    
48890580 tgtcgcatgtcttatgcatcctcagattgaagggcggatgttg 48890622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 48564689 - 48564837
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||| ||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||| ||| ||||||| || |||||||||||    
48564689 ctgtgcctcatgctctgctgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttcgggaagatgactgtgactttggatga 48564788  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||| |||||| || ||||| ||| |||| ||||| ||||||||| ||||    
48564789 tgttgcatgttttatgcatcttcagattaaagggcgaatgttgagccat 48564837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 28 - 166
Target Start/End: Original strand, 3977479 - 3977617
Alignment:
28 cctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcg 127  Q
    ||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || || ||||||||||    
3977479 cctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattagatgatgtcg 3977578  T
128 catgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    |||||||   |||| |||||||||| ||| | |||||||    
3977579 catgtctcacgcatcttccgattgaggggcggatgttga 3977617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 4006654 - 4006513
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||| ||||||||||| |||| |||| |  |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
4006654 gtgcctcatgccctgctgatcactttatgcgaaaggtggcatcctgagaccagcatctttcacatgcccatgggggagatgactgtgacattggatgatg 4006555  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
4006554 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 4006513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 36129278 - 36129419
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| | || |||||||| |||| ||||||||||||| || || ||||||||||    
36129278 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccaacacctttcacatgcccatgggggagatgactgtgacattggatgatg 36129377  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    |||| |||||   |||| |||||||||| ||| | |||||||    
36129378 tcgcttgtctcacgcatcttccgattgaggggcggatgttga 36129419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 52389789 - 52389680
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||||||||||| | || || ||||||||||    
52389789 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgtctgtgacattggatgatg 52389690  T
125 tcgcatgtct 134  Q
    ||||||||||    
52389689 tcgcatgtct 52389680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 41614080 - 41614228
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| |||| |  |||| | ||  ||||||| |||||||||||||||||| || || ||||||||    
41614080 ctgtgcctcatgccatgctgatgactctatgcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgaccttggatga 41614179  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||||    ||| ||| |||||| ||| ||||||||| ||||    
41614180 tgtcgcatgtctgacacatcttcagattgaggggcgaatgttgagccat 41614228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 49142778 - 49142638
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| ||||||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
49142778 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccgaagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 49142679  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
49142678 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 49142638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 23 - 166
Target Start/End: Original strand, 44231532 - 44231674
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||| ||||||| |||||||||||| |||| |  |||| ||||  ||||||| |||||||||| ||||||| || |||||||||||    
44231532 ctgtgcctcatgccctgccgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggg-agatgactgtgactttggatga 44231630  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||||| ||||| |||  ||||| ||| | |||||||    
44231631 tgtcgcatgtcttatgcatcttcaaattgaggggcggatgttga 44231674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 46390744 - 46390853
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
46390744 gtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 46390843  T
125 tcgcatgtct 134  Q
    ||||||||||    
46390844 tcgcatgtct 46390853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 34047218 - 34047358
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
34047218 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 34047317  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
34047318 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 34047358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 54387918 - 54388058
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
54387918 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 54388017  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
54388018 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 54388058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 171
Target Start/End: Complemental strand, 49267608 - 49267461
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    ||||||||||||  ||||||||||| |||||||||| | |||| |  |||| ||||  ||||||  |||||||||||||||||| || || |||||||||    
49267608 tgtgcctcatgccctgctgatgactctatgcgagagatggcatcccgagaccagcacttttcacgtgcccttgggggagatgactgtgaccttggatgat 49267509  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||||||   |||| ||| |||||| ||| | ||||||| ||||    
49267508 gtcgcatgtctaacgcatcttcagattgaggggcggatgttgagccat 49267461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 171
Target Start/End: Complemental strand, 50215338 - 50215191
Alignment:
24 tgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgat 123  Q
    |||||||||||   ||||||||||| |||||||||||| |||| |  |||| |||| |||||||| ||| |||||||||||||| || || |||||||||    
50215338 tgtgcctcatgtcatgctgatgactctatgcgagaggtggcatcctgagaccagcacctttcacatgcctttgggggagatgactgtgaccttggatgat 50215239  T
124 gtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||| ||||||   |||| ||| |||||| ||| | ||||||| ||||    
50215238 gtcgaatgtctgacgcatcttcagattgaggggcggatgttgagccat 50215191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 2273316 - 2273175
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||| ||||||||||||||| |||| ||||    |||| |||| |||||||| | || ||||||||||||| || || ||||||||||    
2273316 gtgcctcatgccctgccgatgactttatgcgaaaggtggcatcttgagaccagcacctttcacatgtccatgggggagatgactgtgacattggatgatg 2273217  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
2273216 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 2273175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 38 - 171
Target Start/End: Complemental strand, 17566398 - 17566265
Alignment:
38 tgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtctttt 137  Q
    ||||||||||| |||||||||||| |||| |  | || ||||  ||||||| |||||||||||||||||| || || ||||||||||||||||||||       
17566398 tgctgatgactctatgcgagaggtggcatcccgacaccagcacttttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtctgac 17566299  T
138 gcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||| ||| |||||| ||| | ||||||| ||||    
17566298 gcatcttcagattgaggggcggatgttgagccat 17566265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 42902420 - 42902311
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
42902420 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 42902321  T
125 tcgcatgtct 134  Q
    ||||||||||    
42902320 tcgcatgtct 42902311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 27 - 134
Target Start/End: Original strand, 29010794 - 29010901
Alignment:
27 gcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatgtc 126  Q
    |||||||||| ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| | |  ||||||||||||| || || ||||||||||||    
29010794 gcctcatgctctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgtcgatgggggagatgactgtgacattggatgatgtc 29010893  T
127 gcatgtct 134  Q
    ||||||||    
29010894 gcatgtct 29010901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 171
Target Start/End: Original strand, 42758553 - 42758627
Alignment:
97 ggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||| || |||||||||||||||||||||||| ||||| ||| |||||||||| | ||||||| ||||    
42758553 ggggagatgacagtgactttggatgatgtcgcatgtcttatgcatcttcagattgaagggcggatgttgagccat 42758627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 95 - 165
Target Start/End: Original strand, 50757982 - 50758052
Alignment:
95 tgggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    |||||||||||||||| |||||||| ||||||||||||||| ||||| ||| |||||||||| | ||||||    
50757982 tgggggagatgaccgtgactttggaggatgtcgcatgtcttatgcatcttcagattgaagggaggatgttg 50758052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 50479037 - 50478928
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||| ||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
50479037 gtgcttcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 50478938  T
125 tcgcatgtct 134  Q
    ||||||||||    
50478937 tcgcatgtct 50478928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 81 - 171
Target Start/End: Original strand, 16645378 - 16645468
Alignment:
81 ctttcacaagcccttgggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||| || |||||||||||||||||| || || ||||||||||||||||||||   |||| |||||||||| ||| | ||||||| ||||    
16645378 ctttcccatgcccttgggggagatgactgtgacattggatgatgtcgcatgtctgacgcatcttccgattgaggggcggatgttgagccat 16645468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 23 - 134
Target Start/End: Original strand, 598667 - 598777
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  || |||||||| ||||||| |||| |||| |  |||| |||| |||||||| | || ||||||||||||| || || ||||||||    
598667 ctgtgcctcatgccctgttgatgactctatgcga-aggtggcatcccgagaccagcacctttcacatgtccctgggggagatgactgtgacattggatga 598765  T
123 tgtcgcatgtct 134  Q
    ||||||| ||||    
598766 tgtcgcacgtct 598777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 46700254 - 46700145
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||| ||||  || ||  |||||||||    
46700254 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggaaatgattgtgacaatggatgatg 46700155  T
125 tcgcatgtct 134  Q
    ||||||||||    
46700154 tcgcatgtct 46700145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 66
Target Start/End: Original strand, 42757937 - 42757980
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcat 66  Q
    |||||||||||||| ||||||||||| |||||||||||| ||||    
42757937 ctgtgcctcatgctctgctgatgactctatgcgagaggtggcat 42757980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 8e-25; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 25 - 171
Target Start/End: Complemental strand, 29399871 - 29399725
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||||||| |||||||||||| |||| |  |||| |||| |||||||| | |||||||||||||||| || || |||||||||     
29399871 gtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacctttcacatgtccttgggggagatgactgtgacattggatgatt 29399772  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||  ||||| |||||||||| ||| | ||||||| ||||    
29399771 tcgcatgtctgatgcatcttccgattgaggggcggatgttgagccat 29399725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 22679324 - 22679433
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| || | ||||||||||||| || || ||||||||||    
22679324 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgctcatgggggagatgactgtgacattggatgatg 22679423  T
125 tcgcatgtct 134  Q
    ||||||||||    
22679424 tcgcatgtct 22679433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 28470330 - 28470439
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| ||||    |||| |||| |||||||| |||| ||||||||||||| || || ||||||||||    
28470330 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcatgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 28470429  T
125 tcgcatgtct 134  Q
    ||||||||||    
28470430 tcgcatgtct 28470439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 39949283 - 39949392
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||||||||||||||||||||||| |||| |  |||| |||| |||||||| |||| ||| ||||||||| || || ||||||||||    
39949283 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatggaggagatgactgtgacattggatgatg 39949382  T
125 tcgcatgtct 134  Q
    ||||||||||    
39949383 tcgcatgtct 39949392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 23 - 165
Target Start/End: Original strand, 40537349 - 40537490
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    ||||||||||||| |||||||||||| ||||| |||||| |||| |  |||| | ||| ||||||| ||||  |||||||||||| || |||||||| ||    
40537349 ctgtgcctcatgcattgctgatgactctatgcaagaggtggcatccagagaccaacaattttcacatgccca-gggggagatgactgtgactttggagga 40537447  T
123 tgtcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||||  ||||| ||| |||||||||| | ||||||    
40537448 tgtcgcatgtctaatgcatcttcagattgaagggcggatgttg 40537490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 10827160 - 10827020
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||||| ||| |||||||||||| |||| |  |||| |||| |||||||| |||||| ||||||||||| || || ||||||||||    
10827160 gtgcctcatgccctgctgataactctatgcgagaggtggcatcctgagaccagcacctttcacatgccctt-ggggagatgactgtgacattggatgatg 10827062  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
10827061 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 10827020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 45430533 - 45430642
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  || ||||||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
45430533 gtgcctcatgccctgttgatgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 45430632  T
125 tcgcatgtct 134  Q
    ||||||||||    
45430633 tcgcatgtct 45430642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 3939018 - 3938878
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
3939018 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 3938919  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
3938918 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 3938878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 25 - 165
Target Start/End: Complemental strand, 30495225 - 30495085
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
30495225 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 30495126  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
30495125 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 30495085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 23 - 134
Target Start/End: Complemental strand, 36654735 - 36654624
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatga 122  Q
    |||||||||||||  ||||||||||| |||||||||||| |||| |  |||| ||||  ||||||| ||||||| || ||||||| || || ||||||||    
36654735 ctgtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgcggaagatgactgtgaccttggatga 36654636  T
123 tgtcgcatgtct 134  Q
    ||||||||||||    
36654635 tgtcgcatgtct 36654624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 5353800 - 5353909
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
5353800 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtaacattggatgatg 5353899  T
125 tcgcatgtct 134  Q
    ||||||||||    
5353900 tcgcatgtct 5353909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 7188625 - 7188766
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||| || ||||||||||| |||| |||| |  |||| | ||||||||||| |||| | ||||||||||| || || ||||||||||    
7188625 gtgcctcatgccctgctaataactttatgcgaaaggtggcatcctgagaccaacaactttcacatgcccataggggagatgactgtgacattggatgatg 7188724  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttga 166  Q
    ||||||||||   |||| |||||||||| ||| | |||||||    
7188725 tcgcatgtctcacgcatcttccgattgaggggcggatgttga 7188766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 17422277 - 17422386
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||| ||||  ||||| |||||||||||||||||| |||| || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
17422277 gtgccttatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 17422376  T
125 tcgcatgtct 134  Q
    ||||||||||    
17422377 tcgcatgtct 17422386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 25 - 165
Target Start/End: Original strand, 43980314 - 43980454
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| | || ||| |||| |||  ||||||||||||| || || ||||||||||    
43980314 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccaacaccttccacatgccgatgggggagatgactgtgacattggatgatg 43980413  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttg 165  Q
    ||||||||||  ||||| |||| ||||| ||| | ||||||    
43980414 tcgcatgtctcatgcatcttcctattgaggggcggatgttg 43980454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 25 - 171
Target Start/End: Original strand, 15833049 - 15833195
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| | || || |||| |||| ||| |||| |||  ||||||||||||| || || ||||||||||    
15833049 gtgcctcatgccctgctgcttactttatgcgagaggtggtatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 15833148  T
125 tcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    ||||||||||   |||| |||| ||||| ||| | |||||| |||||    
15833149 tcgcatgtctcacgcatcttcctattgaggggcggatgttggaccat 15833195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 43537968 - 43537859
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  ||||| | |||||||||||||||| |||| || |||| |||| ||| |||| ||   ||||||||||||| || || ||||||||||    
43537968 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgctgatgggggagatgactgtgacattggatgatg 43537869  T
125 tcgcatgtct 134  Q
    ||||||||||    
43537868 tcgcatgtct 43537859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 14192 - 14083
Alignment:
25 gtgcctcatgctttgctgatgactttatgcgagaggtagcatacgaagactagcaactttcacaagcccttgggggagatgaccgttactttggatgatg 124  Q
    |||||||||||  |||| ||||||||||||||||||| |||| |  |||| |||| |||||||| |||| | ||||||||||| || || ||||||||||    
14192 gtgcctcatgccctgcttatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccataggggagatgactgtgacattggatgatg 14093  T
125 tcgcatgtct 134  Q
    ||||||||||    
14092 tcgcatgtct 14083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0238 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0238
Description:

Target: scaffold0238; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 96 - 171
Target Start/End: Complemental strand, 17237 - 17162
Alignment:
96 gggggagatgaccgttactttggatgatgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccat 171  Q
    |||||||||||  || |||||||||||||||||||||||| ||||| ||| |||||||||| | ||||||| ||||    
17237 gggggagatgaatgtgactttggatgatgtcgcatgtcttatgcatcttcagattgaagggcggatgttgagccat 17162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0238; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 66
Target Start/End: Complemental strand, 17286 - 17243
Alignment:
23 ctgtgcctcatgctttgctgatgactttatgcgagaggtagcat 66  Q
    |||||||||||||| ||||||||||| |||||||||||| ||||    
17286 ctgtgcctcatgctctgctgatgactctatgcgagaggtggcat 17243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0155 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 182
Target Start/End: Original strand, 11262 - 11323
Alignment:
121 gatgtcgcatgtcttttgcatattccgattgaagggtgaatgttgaaccatccaaggaagat 182  Q
    ||||||||||||||| ||||| |||  ||||||||| | ||||||| |||||||| ||||||    
11262 gatgtcgcatgtcttatgcatcttcatattgaagggaggatgttgagccatccaaagaagat 11323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University