View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19791_high_10 (Length: 304)
Name: NF19791_high_10
Description: NF19791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19791_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 3435540 - 3435390
Alignment:
| Q |
1 |
ccaaaaataactaatgttgagatttcatttaaaatatatattacgaaatcgtt-ttgtaaaaagattcgttttggaaatgaagttggctcctttannnnn |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3435540 |
ccaaaaataactaatgttgagattccatttaaaatatatattacgaaatcgttgttgtaaaaagattcgttttggaaatgaagttggctcctttattttt |
3435441 |
T |
|
| Q |
100 |
nnaatgttattaaaaaactaagtaaactttcatttcttagaacacacaaat |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3435440 |
ttaatgttattaaaaaactaagtaaactttcatctcttagaacacacaaat |
3435390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 236 - 291
Target Start/End: Complemental strand, 3435304 - 3435249
Alignment:
| Q |
236 |
gttcgttaattttctatccccgtgaccaattacaagcattcaccataccccctatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3435304 |
gttcgttaattttctatccccgtgaccaattataagcattcaccataccccctatg |
3435249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University