View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19791_low_6 (Length: 398)
Name: NF19791_low_6
Description: NF19791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19791_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Complemental strand, 18513984 - 18513619
Alignment:
| Q |
18 |
gcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513984 |
gcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatca |
18513885 |
T |
|
| Q |
118 |
tgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513884 |
tgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctg |
18513785 |
T |
|
| Q |
218 |
tagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcaattgtgaccgcatgttgca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18513784 |
tagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcagttgtgaccgcatgttgca |
18513685 |
T |
|
| Q |
318 |
gacaactacatgcaactgtaatatt--gcggccgcgtcatgtgcagttagaaacctttcttgtaac |
381 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18513684 |
gacaactacatgcaactgtaatattgcgcggccgcgtcatgtgcagttagagacctttcttgtaac |
18513619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University