View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19791_low_7 (Length: 363)
Name: NF19791_low_7
Description: NF19791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19791_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 21120910 - 21120622
Alignment:
| Q |
18 |
cttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaatggcggaatcaaccttctttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120910 |
cttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaatggcggaatcaaccttctttgga |
21120811 |
T |
 |
| Q |
118 |
gcagcctcgcaaacaacaacaacaccacgcctctggaccgtattcaaagagaacgtaccttgtgaaaggactctagattgggaaatgtttcgggagaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120810 |
gcagcctcgcaaacaacaacaacaccacgcctctggaccgtattcaaagagaacgtaccttgtgaaaggactctagattgggaaatgtttcgggagaaac |
21120711 |
T |
 |
| Q |
218 |
ttagtgaaccggaatttgatgatgaagttagggtaaggttcttcattttcgaaggaaggttcaacaatgaacatgaaactgaagccata |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120710 |
ttagtgaaccggaatttgatgatgaagttagggtaaggttcttcattttcgaaggaaggttcaacaatgaacatgaaactgaagccata |
21120622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University