View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19792_low_4 (Length: 237)
Name: NF19792_low_4
Description: NF19792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19792_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 11029620 - 11029823
Alignment:
| Q |
19 |
ggttttagtcttaaataatgtttctagggtttgatacttatatttgctggttgattactcattataaattcaaaaatgctaaatatagcgaagggaatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11029620 |
ggttttagtcttaaataatgtttctagggtttgatacttatatttgctggttgattactcattataaattcaaaaatgctaaatatagcgaagggaatga |
11029719 |
T |
|
| Q |
119 |
tcccgaatgtaaaacctccctcgttttgcaatgctatcccgttgtaaaaccatagtatttgtaattctaacttataagttatgcccctcaggttttttct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11029720 |
tcccgaatgtaaaacctccctcgttttgcaatgctatcccgttgtaaaaccattgtatttgtaattctaacttataagttatgcccctcaggttttttct |
11029819 |
T |
|
| Q |
219 |
tcat |
222 |
Q |
| |
|
|||| |
|
|
| T |
11029820 |
tcat |
11029823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 1836896 - 1836848
Alignment:
| Q |
174 |
tatttgtaattctaacttataagttatgcccctcaggttttttcttcat |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
1836896 |
tatttgtaattctaacttataacttatgcccctcagtttttttcttcat |
1836848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University