View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_16 (Length: 294)
Name: NF19793_high_16
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_16 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 226619 - 226850
Alignment:
| Q |
10 |
tcctctcatacttggtgtactactcacaccaccactctttggaatatctccactagctgaatcaaaactattcctgcgtgctctccataggtcaccactg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226619 |
tcctctcatacttggtgtactactcacaccaccactctttggaatatctccactagctgaatcaaaactattcctgcgtgctctccataggtcaccactg |
226718 |
T |
 |
| Q |
110 |
aatccatctaaccaccaatcgatattaccactgcgattattcccgcttcttctctttcccttctttctgtccccgtataatgcatcatcactcatccacc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226719 |
aatccatctaaccaccaatcgatattaccactgcgattattcccgcttcttctctttcccttctttctgtccccgtataatgcatcatcactcatccacc |
226818 |
T |
 |
| Q |
210 |
aattatcaccattgctaataccatcatcacca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
226819 |
aattatcaccattgctaataccatcatcacca |
226850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University