View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_20 (Length: 281)
Name: NF19793_high_20
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 45088688 - 45088437
Alignment:
| Q |
18 |
cccttaaactgaaattttgagggcccttaaactgagtgcccttagatctagaatttgcccaatgcgcctgcacttaaactgaatgttgagttccatattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088688 |
cccttaaactgaaattttgagggcccttaaactgagtgcccttagatctagaatttgcccaatgcgcctgcacttaaactgaatgttgagttccatattc |
45088589 |
T |
 |
| Q |
118 |
atcatgatgtctacttcttcataannnnnnncagccaaagcaattgcttgaagataagcaaggattcaagaatgtggaaatttaataagttggaatttat |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088588 |
atcatgatgtctacttcttcataa-ttttttcagccaaagcaattgcttgaagataagcaaggattcaagaatgtggaaatttaataagttggaatttat |
45088490 |
T |
 |
| Q |
218 |
ttgtttttatgtctttgtttgataggttaggttaatttagtatgtttcctttg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088489 |
ttgtttttatgtctttgtttgataggttaggttaatttagtatgtttcctttg |
45088437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University