View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_28 (Length: 244)
Name: NF19793_high_28
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 9136094 - 9136329
Alignment:
| Q |
1 |
actttccaatggcagtggctatgctcagaaagtgcacatgaatgacatgaatgctctttcaatctcctccaacccaacttcatgcttttcttcaatgcct |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9136094 |
actttccaatggcagtgcctatgctcagaaagtgcacatgaatgacatgaatgctctttcaatctcctccaacccaacttcatgcttttcttcaatgcct |
9136193 |
T |
|
| Q |
101 |
tatcgttttatgtcagctcgagccaaatgcatgcgaaaatggtactactagtaaataaatttagtcagtaaatggtttaaatgcagtgggacacataaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9136194 |
tatcgttttatgtcagctcgagccaaatgcatgcgaaaatggtactactagtaaataaattcagtcagtgaatggtttaaatgcagtgggacacataaga |
9136293 |
T |
|
| Q |
201 |
gatctagaacctgctccatcattattgccctttgct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9136294 |
gatctagaacctgctccatcattattgcccattgct |
9136329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University