View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_35 (Length: 227)
Name: NF19793_high_35
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 51 - 174
Target Start/End: Original strand, 33359921 - 33360039
Alignment:
| Q |
51 |
gtgaggagtaattttgtaagnnnnnnnattttattaacataaatgcgaggagtaattttgtaatttgtgtgtatttaaatacattaatcaatttgcataa |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| | | |||||||| ||||| ||||||| |
|
|
| T |
33359921 |
gtgaggagtaattttgtaagtttttttattttattaacttaaatgcgaggagtaattttgtaatttgtggg----tgaatacattgatcaa-ttgcatat |
33360015 |
T |
|
| Q |
151 |
atttcgttattccccaagttcaaa |
174 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33360016 |
atttcgttattccccaagttcaaa |
33360039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University