View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_36 (Length: 225)
Name: NF19793_high_36
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 100 - 208
Target Start/End: Complemental strand, 5798639 - 5798531
Alignment:
| Q |
100 |
agattggagtcagagtgagattattattcttcccgaggatttggaattgagtaaacaaatgaatgaattgggtctccctctttcctttcaggcaaataat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5798639 |
agattggagtcagagtgagattattattcttcccgaggatttggaattgagtaaacaaatgaatgaattgggtctccctctttcctttcaggcaaagaat |
5798540 |
T |
|
| Q |
200 |
gaggtactt |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
5798539 |
gaggtactt |
5798531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 5798721 - 5798665
Alignment:
| Q |
18 |
ttctcattctttacctacttatttttcactgattaattaatcaatgaaaatgaaagg |
74 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5798721 |
ttctcattctttacttatttatttttcactgattaattaatcaatgaaaatgaaagg |
5798665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University