View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_high_44 (Length: 202)
Name: NF19793_high_44
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 35772401 - 35772567
Alignment:
| Q |
19 |
ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagtagagattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35772401 |
ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattg |
35772500 |
T |
|
| Q |
119 |
atctcaacaaattcgacccatgggatctcccaagtatcaaactttttcacaccccacttcatctttt |
185 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35772501 |
atctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatctttt |
35772567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 143
Target Start/End: Original strand, 33761848 - 33761969
Alignment:
| Q |
22 |
ttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagtagagattgatc |
121 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||||||| |||||||| | |||||| ||||| || ||| | |||||||||||||||| || |||||| |
|
|
| T |
33761848 |
ttccgatttcaccctacagatgaagagcttgttgttcattacctcaagaaaaaagcagcttcagctcctttaccagtagccatcatagctgaagttgatc |
33761947 |
T |
|
| Q |
122 |
tcaacaaattcgacccatggga |
143 |
Q |
| |
|
|| ||||||| || |||||||| |
|
|
| T |
33761948 |
tctacaaatttgatccatggga |
33761969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University