View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_low_30 (Length: 254)
Name: NF19793_low_30
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 52592224 - 52592464
Alignment:
| Q |
14 |
attatactggtattgaaatggagggacagatgcattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592224 |
attatactggtattgaaatggagggacagatacattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctaca |
52592323 |
T |
|
| Q |
114 |
tgagagttgtaagcattggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcgtgttaaacttgattccattttgttctgctacagatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592324 |
tgagagttgtaagcattggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcatgttaaacttgattccattttgttctgctacagatt |
52592423 |
T |
|
| Q |
214 |
cattgtagtaattgtaaggtaacaaaggactcgaggtgaac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592424 |
cattgtagtaattgtaaggtaacaaaggactcgaggtgaac |
52592464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University