View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_low_33 (Length: 248)
Name: NF19793_low_33
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 34886365 - 34886225
Alignment:
| Q |
1 |
gtagatacttatgctgatttatgacaatggaacatggataagttttacctacttgattcccaatggggatgnnnnnnntgaactcatctccgtccatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
34886365 |
gtagatacttatgctgatttatgacaatggaacatggataagttttacctacctgattcccaatggggatg-aaaaaatgaactcatctccgttcatgaa |
34886267 |
T |
|
| Q |
101 |
tccgccctggatctagaaatttctccaaatccaagacccaaa |
142 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
34886266 |
tccgtcctggatctaaaaatttctccaaatccatgacccaaa |
34886225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University